ID: 1200282193

View in Genome Browser
Species Human (GRCh38)
Location X:154786337-154786359
Sequence CAATCTGATCCCTTGCAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200282193_1200282198 30 Left 1200282193 X:154786337-154786359 CCTCCTTGCAAGGGATCAGATTG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1200282198 X:154786390-154786412 CTCATGAACATCTAAAAAGAAGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200282193 Original CRISPR CAATCTGATCCCTTGCAAGG AGG (reversed) Exonic
906013404 1:42551137-42551159 CAATCTCTTCATTTGCAAGGTGG - Intronic
907510447 1:54954199-54954221 CACTCTGAGCCCTTGGAGGGTGG - Intergenic
908484442 1:64576778-64576800 CACTCTGTTCTCTTGCCAGGTGG + Intronic
908874441 1:68655090-68655112 CAATATAAGCCTTTGCAAGGTGG + Intergenic
911026610 1:93442528-93442550 CAAACTGTTCCCTTGAAAGCAGG - Intergenic
912115272 1:106399008-106399030 CAATCTGATTTAGTGCAAGGAGG + Intergenic
917498720 1:175566427-175566449 CAGGCTGTTCTCTTGCAAGGCGG - Intronic
917506159 1:175629010-175629032 CAATCTGATCCACTCCAATGGGG - Intronic
919657914 1:200215189-200215211 CACTCTGATGCCTTGCGGGGGGG + Intergenic
923348622 1:233081585-233081607 CAAGCTGATGACTTGCAAAGTGG + Intronic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1065181834 10:23134019-23134041 CACTGTGAGCCCTTGCAAGTTGG - Intergenic
1067568031 10:47352092-47352114 CCATGGGATCCCTTGCAAGGAGG + Intronic
1070497342 10:77036440-77036462 CAAAATGCTCCCTTGCAGGGTGG - Intronic
1071458006 10:85865842-85865864 GCATCTGCTTCCTTGCAAGGCGG - Intronic
1073019875 10:100434180-100434202 AAATCTGATCCATTGCAATTAGG + Intergenic
1073102323 10:101012867-101012889 CAATCAGTTCCCTTGGAGGGGGG + Intronic
1077458373 11:2694514-2694536 AAATCTGACCCCTTGCAACCAGG - Intronic
1078924338 11:15860443-15860465 CAATCTGTTCCCTAGGAAGAGGG + Intergenic
1089813690 11:121153106-121153128 GAATCTGATCATTGGCAAGGAGG - Intronic
1090151794 11:124392545-124392567 CCTTCACATCCCTTGCAAGGTGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1093938990 12:25032218-25032240 TAATCTCACACCTTGCAAGGTGG + Intronic
1097452739 12:59755538-59755560 CCTTCTCATCCCTTGTAAGGTGG - Intronic
1097730115 12:63119043-63119065 CAATTTGATCTCTGGCTAGGAGG + Intergenic
1098184362 12:67880418-67880440 TAATCTGACCCCTTCAAAGGTGG + Intergenic
1101003813 12:100382249-100382271 CAATCTGGCCCCCTGCAATGGGG - Intronic
1103187344 12:118970540-118970562 CAGTCTGATCTCCTTCAAGGAGG - Intergenic
1105868223 13:24480214-24480236 CAATCTGTGCCCATACAAGGTGG + Intronic
1108140437 13:47415616-47415638 CAATCTGTTCCCTTCCATGGAGG - Intergenic
1108917514 13:55633763-55633785 GAATCTGATCAATTGGAAGGAGG - Intergenic
1109692798 13:65915061-65915083 TAATCTGATCCCTTTCGAAGTGG - Intergenic
1117128731 14:52662414-52662436 CAATCTCATCCCCTTCTAGGAGG + Intronic
1119325188 14:73755615-73755637 CAATCTGATCTCTGGGAAGCTGG + Intronic
1122663067 14:103310814-103310836 CAAGCTGAGCCCTGGGAAGGTGG - Intergenic
1124604748 15:31161784-31161806 CAGTCTGTTCCCTTGCATGTGGG - Intergenic
1126432123 15:48597512-48597534 CTGTCTGATCCTGTGCAAGGAGG - Intronic
1126474200 15:49049187-49049209 CAAGCTCATCCCTTGGAATGAGG + Intergenic
1126966382 15:54059396-54059418 CCTTCTCATCCCTTGCAAGTTGG - Intronic
1133570845 16:7038524-7038546 GCATCTGATACCTTGCAGGGTGG - Intronic
1137902893 16:52288274-52288296 AAATTTCATCCCTTGCAAAGGGG + Intergenic
1137922677 16:52506438-52506460 CAATCTGATACATTGCTTGGTGG - Intronic
1150152852 17:62824780-62824802 GAATCTGATTCCTTGCAATGAGG - Intergenic
1153391376 18:4564144-4564166 TAATCACTTCCCTTGCAAGGTGG - Intergenic
1154246824 18:12706576-12706598 TAATCAGATCCATTGCAAGCTGG - Exonic
1166025673 19:40082112-40082134 GAATCTTATCCCTTGAAAAGAGG + Intronic
927744634 2:25606288-25606310 CAGTCTCATCCCTTGAAAGCTGG + Intronic
927952866 2:27185197-27185219 CAAACTAATCACTAGCAAGGAGG - Intergenic
929224693 2:39500818-39500840 CAATATCATCCCTCGAAAGGTGG + Intergenic
934617635 2:95784655-95784677 CAATGTGATCCCTTATAAGATGG - Intergenic
934643258 2:96039904-96039926 CAATGTGATCCCTTATAAGATGG + Intergenic
934730513 2:96653712-96653734 CAAACTGGTCCCCAGCAAGGTGG + Intergenic
934847598 2:97672271-97672293 AGATCTGCTCCCTTGCAAGCAGG - Intergenic
934849362 2:97687687-97687709 AGATCTGCTCCCTTGCAAGCAGG - Intergenic
937634106 2:124136459-124136481 CAAACTGATCCCATTTAAGGTGG - Intronic
945048208 2:205800236-205800258 CAATAAGTTCCCTGGCAAGGGGG + Intergenic
946518048 2:220434751-220434773 CAAACTGACTCCTTGTAAGGTGG - Intergenic
1169376936 20:5073713-5073735 TAATCTGATTCCCTTCAAGGAGG - Intronic
1172298175 20:33828630-33828652 TATTCTGATCCCTTGCATGGAGG - Intronic
1175681582 20:60992977-60992999 CAATCTCATTCATTGAAAGGTGG + Intergenic
1175842839 20:62041236-62041258 CAATCTGTGCACTTACAAGGGGG + Intronic
1176879245 21:14171147-14171169 CAATCACATCCCTTGTAAGTTGG - Intronic
1181941274 22:26479352-26479374 CACTCTGTTCTCTTGCCAGGTGG - Exonic
1182022495 22:27092430-27092452 CAGTCTGCTCCTTTGCAAAGAGG + Intergenic
949133206 3:530553-530575 CAGTCTGATCCCTGGCACAGAGG + Intergenic
952646780 3:35669576-35669598 CAATCTGATCCCTGAAATGGAGG - Intronic
953219986 3:40960866-40960888 CTATCAGATCCCTTGCAGGATGG + Intergenic
956848744 3:73208368-73208390 CAATAGGATACCTTGCAAGGTGG - Intergenic
958663765 3:97106847-97106869 CCATCACATGCCTTGCAAGGAGG + Intronic
961744013 3:129052053-129052075 CCATCAGATCCCTTGCTTGGGGG + Intergenic
962369787 3:134811686-134811708 AAAACTGATTCCTGGCAAGGAGG - Intronic
969447166 4:7252021-7252043 CAGTCATATCACTTGCAAGGTGG + Intronic
974866407 4:67586505-67586527 CAGCCTGATCCCTTTTAAGGTGG + Intronic
977269180 4:94894042-94894064 ATATGTGATCCCTTTCAAGGTGG - Intronic
980726985 4:136775292-136775314 CAATGTGAACACTTGAAAGGTGG - Intergenic
981568400 4:146125489-146125511 CAATGTGTTACCTTGCAAGTAGG - Intergenic
981955105 4:150462096-150462118 GAATCTTATCTCTTCCAAGGAGG + Intronic
989466292 5:41759323-41759345 CAATCTGAGTCCTTACCAGGTGG - Intronic
992019227 5:72605904-72605926 AAATCTAATCCCTTGTATGGAGG - Intergenic
992423607 5:76632433-76632455 CCAACTGATCCCTTGCAGGCTGG - Intronic
997787065 5:136723114-136723136 AAGTCTGATCCCTTCCCAGGGGG + Intergenic
1000401378 5:160831721-160831743 CAATCTCTTCCCTGGTAAGGAGG - Intronic
1004240597 6:13917769-13917791 CATACTGATCCCTGGGAAGGGGG - Intergenic
1008959203 6:57248685-57248707 CAGTCTGATCCATTGCAGGAGGG + Intergenic
1012469176 6:99551404-99551426 TAAACAAATCCCTTGCAAGGTGG + Intronic
1015288613 6:131511782-131511804 CAAGCACATCTCTTGCAAGGGGG + Intergenic
1016684804 6:146869018-146869040 CATTCTGATCACCTGCAAAGTGG + Intergenic
1018618698 6:165710487-165710509 CAAACTGATCCCTTTTAAAGAGG + Intronic
1024472420 7:49776801-49776823 AAATCTCATCCCATGCTAGGAGG + Intronic
1025101853 7:56142248-56142270 CTCTCTGATGGCTTGCAAGGAGG + Intergenic
1028851362 7:95541815-95541837 CAATGAGATCCCTAGCAGGGAGG + Intergenic
1032676128 7:134131566-134131588 CAATCTCATCCCTACCTAGGAGG - Intronic
1060753239 9:126189007-126189029 TCCTCTGATCCCATGCAAGGAGG + Intergenic
1194888862 X:99353469-99353491 CAATCTGCCCCCTTGCAGGATGG - Intergenic
1195538320 X:106034124-106034146 CAATCTGATGCCTAGAGAGGCGG - Intronic
1195928454 X:110049698-110049720 CCATCTGATGACATGCAAGGAGG + Intronic
1199104426 X:143846490-143846512 CAATCTTATCACTTGCAAATAGG - Intergenic
1199796145 X:151199819-151199841 CAATATGATCCGTTCCAAGATGG + Intergenic
1200282193 X:154786337-154786359 CAATCTGATCCCTTGCAAGGAGG - Exonic