ID: 1200282640

View in Genome Browser
Species Human (GRCh38)
Location X:154790933-154790955
Sequence ACACTTATGGAGACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200282637_1200282640 -10 Left 1200282637 X:154790920-154790942 CCAATGTGGATCAACACTTATGG 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200282640 Original CRISPR ACACTTATGGAGACAATGGA AGG Intronic
901601785 1:10428418-10428440 ACACTTAGGGAGACCAAGGCAGG - Intergenic
901838696 1:11940267-11940289 ACACTTAGGGAGACCAAGGCAGG - Intronic
903133924 1:21296970-21296992 AGACTCAGGGAGACACTGGAAGG + Intronic
904649679 1:31995496-31995518 ACACTTAGGGAGGCAAAGGCAGG - Intergenic
905079582 1:35305793-35305815 ACACTTTGGGAGGCAAAGGAAGG - Intronic
907201798 1:52733425-52733447 ACACTTTGGGAGACAAAGGTGGG + Intronic
908135938 1:61132628-61132650 ACAATTAAGGAGAAAAGGGATGG + Intronic
908972227 1:69850573-69850595 GCAGTTATGGAGACAATGAGTGG + Intronic
910435394 1:87200834-87200856 ACCCTTATGAAGACAAAAGAAGG + Intergenic
911262520 1:95702570-95702592 ACACTTTGGGAGACAGAGGAGGG - Intergenic
911911086 1:103636518-103636540 ACACATATGGAGTGAATGTAGGG + Intergenic
911918501 1:103730660-103730682 ACACATATGGAGTGAATGTAGGG + Intronic
912893903 1:113564571-113564593 AAACTTAAGGAGACATTGGTTGG + Intronic
915449919 1:155997637-155997659 ACACTTAGGGAGACTAAGGCAGG + Intronic
915573447 1:156759053-156759075 AGAATTATGGTGACAATGAATGG + Intronic
915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG + Intronic
916540262 1:165746806-165746828 ACAGTGATGGAGAGAAAGGAAGG + Intronic
916659697 1:166911006-166911028 ACAGTTAGGGAGACAAAGGTGGG - Exonic
916671671 1:167027675-167027697 AAAATTATTGAGAAAATGGAGGG + Intergenic
917539455 1:175898826-175898848 ACACTTAAGGTGTCCATGGATGG + Intergenic
918146823 1:181764003-181764025 ACACTGATGAAGACAAAGGTGGG - Intronic
918432513 1:184476790-184476812 ACTGTTTTGGAGACAAAGGAAGG - Intronic
919355322 1:196515676-196515698 ACTCTTATGGAGAAAAGTGAAGG + Intronic
920075835 1:203335797-203335819 ACACTTGTGGAGAAAATGTGGGG + Intergenic
921025096 1:211271244-211271266 ACACAGATAAAGACAATGGAGGG + Exonic
922876484 1:228943570-228943592 ACACTTATGCTGTCCATGGATGG + Intergenic
923191671 1:231626437-231626459 ACAGTGATGGAGAAGATGGAGGG - Intronic
923933895 1:238738029-238738051 ACAATAATGGACAAAATGGAAGG + Intergenic
1062870241 10:895450-895472 ACACTTTGGGAGACAAGGTAGGG + Intronic
1064043378 10:11988549-11988571 ACACTTTTGGAGACCAAGGCAGG - Intronic
1065314258 10:24446949-24446971 ACACTGATGAAGACAGTGGTGGG - Intronic
1065669270 10:28096656-28096678 AAAGTTATAGAAACAATGGAAGG - Intronic
1066045135 10:31588138-31588160 GGAATTATGGAGACAATGGAGGG - Intergenic
1066045739 10:31594257-31594279 ACAGTAATGGAGACAATAGAAGG + Intergenic
1069447809 10:68490012-68490034 ACACTTATGGAGGCTAAGGTGGG + Intronic
1070675190 10:78407307-78407329 CCACCTAGGGAGACAAGGGAGGG + Intergenic
1072005612 10:91243904-91243926 TCACTTATATAGACAATAGAAGG + Intronic
1076263716 10:129092731-129092753 TTAATTATGGAGACAATGCAAGG + Intergenic
1077287052 11:1772171-1772193 AAAATTATGGAGACAGTGAAAGG + Intergenic
1078199287 11:9165678-9165700 ACACTTTGGGAGACCATGGCAGG - Intronic
1080193976 11:29585978-29586000 ACACACATGGAGGCAATGGAAGG + Intergenic
1081324918 11:41732472-41732494 ACTCTTATTCAGACAATGTAGGG - Intergenic
1081823526 11:46023707-46023729 ACACTTTTGGAGACAGAGGTGGG + Intronic
1081933986 11:46892177-46892199 GCACTTTTGGAGACCAAGGAAGG - Intronic
1082070914 11:47938868-47938890 ACAGTTATTGAGTGAATGGAGGG + Intergenic
1083918613 11:65767255-65767277 ACACTTTGGGAGACCAAGGAGGG + Intergenic
1084685985 11:70695671-70695693 ACACTGATGGAGGGAAAGGAAGG - Intronic
1087266670 11:96069172-96069194 ACACTTTGGGAGACCATGGTGGG - Intronic
1088013700 11:105034634-105034656 ACATGTATGGAGACTATTGAGGG - Intronic
1088019374 11:105100939-105100961 ACATGTATGGAGACTATTGAGGG - Intronic
1088216540 11:107516770-107516792 ACACTTTGGGAGACAAAGGTGGG + Intronic
1089223191 11:116893010-116893032 AAACTTGTGGAGACAGTGAAAGG + Intronic
1090978690 11:131697443-131697465 ATACTTGAGGAGATAATGGAGGG - Intronic
1091813170 12:3416522-3416544 ACACTTGTGGAGTCACTGGTGGG + Intronic
1092340446 12:7671590-7671612 GCACTTTTGGAGGCCATGGAGGG - Intergenic
1092862336 12:12729504-12729526 ACACTTTTGGAGACCAAGGCAGG - Intronic
1094790653 12:33910419-33910441 ACACATATGGACACAAAGAAGGG - Intergenic
1095592320 12:43917144-43917166 ACACTTTTGGAGGCCATGGTGGG + Intronic
1097063561 12:56303611-56303633 ACACTTTGGGAGACCAAGGAAGG - Intronic
1097638746 12:62153414-62153436 GCACTTTGGGAGACAATGGTGGG + Intronic
1099694704 12:86003045-86003067 ACACTTTGGGAGACAAAGGTAGG - Intronic
1099905521 12:88765321-88765343 ACACTTTTAGAGACAATAGATGG - Intergenic
1100051678 12:90456855-90456877 ACACATATGCACACAATGGATGG - Intergenic
1100382247 12:94072850-94072872 ACACTTTGGGACACAGTGGAAGG - Intergenic
1101068244 12:101045861-101045883 CCACTTAAGGAGACAAGGGAAGG - Intronic
1101114359 12:101517820-101517842 ACACTCAGGGAGAGCATGGAAGG - Intergenic
1102978846 12:117225873-117225895 ACACTTTTGGAGGCCAAGGAAGG - Intronic
1103773467 12:123347470-123347492 ACACTTTTGGAGGCCAGGGAGGG - Intronic
1106062616 13:26309632-26309654 ACACCTAGGGAGAGAATGTAGGG - Intronic
1106096261 13:26646882-26646904 ACACTTATGGAGACAGTTCAGGG + Intronic
1106275401 13:28200872-28200894 ACATTTAAGGAGTAAATGGATGG - Intronic
1108379094 13:49839797-49839819 ACACTTTGGGAGGCAATGGTGGG + Intergenic
1108397528 13:50004827-50004849 ACACTTAGGGAGGCCAAGGAGGG + Intronic
1110972010 13:81775595-81775617 ACACATATGGACACAAAGAAGGG - Intergenic
1111136770 13:84056476-84056498 ACCCTAATGGATATAATGGAAGG + Intergenic
1112763048 13:102712104-102712126 ACACTTTTGGAGACCAAGGCAGG + Intergenic
1118104870 14:62647141-62647163 ACAATGTTGGAGAAAATGGAGGG - Intergenic
1119160937 14:72451994-72452016 ACACTTTTGGAGACCGAGGAGGG - Intronic
1120484160 14:85089190-85089212 ACAGCTATGGATACAATTGATGG + Intergenic
1122170933 14:99875027-99875049 ACAGAGATGGAAACAATGGAAGG - Intronic
1122576730 14:102747586-102747608 ACACTTGCGAAGACAATGGAAGG + Intergenic
1123835641 15:24189125-24189147 ACACTTTGGGAGACTAAGGAGGG - Intergenic
1125582389 15:40795534-40795556 ACACTCATGGAGAAAAGGAAGGG + Intronic
1125829381 15:42703039-42703061 ACACTTTAGGAGACTATGGTAGG - Intronic
1126693425 15:51305805-51305827 ACACTTTGGGAGACCAAGGAGGG - Intronic
1127598009 15:60506457-60506479 ACACGTATGAACACACTGGAAGG + Intronic
1128413472 15:67422161-67422183 ACACTAATGGACAGAATTGAGGG - Intronic
1130261780 15:82359977-82359999 ACACTTTGGGAGACCATGGTGGG - Intergenic
1130279454 15:82509034-82509056 ACACTTTGGGAGACCATGGTGGG + Intergenic
1130470833 15:84225223-84225245 ACACTTTGGGAGACCATGGTGGG + Intergenic
1130478322 15:84339791-84339813 ACACTTTGGGAGACCATGGTGGG + Intergenic
1130493443 15:84448339-84448361 ACACTTTGGGAGACCATGGTGGG - Intergenic
1130593122 15:85229850-85229872 ACACTTTGGGAGACCATGGTGGG + Intergenic
1131631662 15:94183164-94183186 GCACTTAGGGAGGCAAAGGAAGG + Intergenic
1135793301 16:25418400-25418422 ACAATTATCTAGACAAGGGATGG - Intergenic
1138983317 16:62296995-62297017 GCACTTAAGAAGACAGTGGAGGG + Intergenic
1148631352 17:49111871-49111893 ACACTTTGGGAGACAAAGGCAGG - Intergenic
1148882365 17:50739403-50739425 GCACTTTTGGAGGCAAAGGAGGG + Intronic
1154160603 18:11978596-11978618 ACACTTTAGGAGACAAAGGTAGG - Intergenic
1157086457 18:44585378-44585400 ACACTTTGGGAGACAAAGGTGGG + Intergenic
1157206701 18:45706849-45706871 AAAATTATGGAGGAAATGGAAGG - Intergenic
1158423550 18:57318316-57318338 ACACATAGGGAGAAAATGAAGGG - Intergenic
1159153897 18:64556827-64556849 TCACTTAGGGAGAGAATGGGAGG + Intergenic
1159487257 18:69078518-69078540 AAACCTATGGAGACACTAGAAGG + Intergenic
1160127200 18:76186488-76186510 ACACATATGCAGACTATGAAAGG + Intergenic
1160217799 18:76948532-76948554 ATACTTGTGGTTACAATGGAAGG + Intronic
1160319906 18:77880567-77880589 ACACTTAGGGAATCAATGGATGG - Intergenic
1160467373 18:79091443-79091465 ACACTGATGAAGGCAATTGAAGG - Intronic
1161687524 19:5710622-5710644 ACACTTTTGGAGGCCAAGGAAGG - Intronic
1161940471 19:7400015-7400037 ACACTTTGGGAGACAAAGGTAGG - Intronic
1164209422 19:23085760-23085782 TCACTTTTGGAGACAAAGGCGGG - Intronic
1164517615 19:28949524-28949546 ACACTTTTGGAGACCAAGGTGGG - Intergenic
1166157992 19:40929716-40929738 GCACTCATGGAGACACTGGATGG - Intergenic
1167658551 19:50782179-50782201 ACACTTTGGGAGACCATGGTGGG + Intergenic
924992927 2:329384-329406 ACATTTTGGGAGAAAATGGAGGG + Intergenic
928764117 2:34621506-34621528 AAACTAATGGAAACAAAGGATGG + Intergenic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
929458864 2:42086453-42086475 TCACTCATGGAAAGAATGGATGG + Intergenic
930060578 2:47285054-47285076 AAGCTTATGGTGACAATGAATGG + Intergenic
931198940 2:60078390-60078412 ACACTGATGCAAACAATGGGTGG - Intergenic
932449280 2:71799260-71799282 AAACTGTTGGAGATAATGGAAGG + Intergenic
932766794 2:74475513-74475535 ACAAGGATGGAGACAGTGGAGGG + Intronic
935211726 2:100944508-100944530 GCAATTATGGAGACAAGGGAGGG - Intronic
935798337 2:106667502-106667524 ACACTTTAGGAGACCAAGGAGGG - Intergenic
937725217 2:125156503-125156525 ACACTTTGGGAGGCCATGGATGG - Intergenic
938103886 2:128516613-128516635 ACAATTATGAAGACAAGGGAAGG - Intergenic
938660993 2:133487214-133487236 AGAGTTATAGACACAATGGAGGG + Intronic
939426652 2:142047140-142047162 ACAGTTGTGGAGACAATGCAGGG + Intronic
940000983 2:148965915-148965937 ACACGTGGGGAGACCATGGAAGG - Intronic
940304510 2:152211418-152211440 GCACTTTTGGAGACCATGGCAGG - Intergenic
940651712 2:156447281-156447303 ACAGTTGTGGAGGGAATGGAAGG - Intronic
940816198 2:158300552-158300574 AGACTTATTCAGACAAAGGAAGG + Intronic
940989327 2:160082142-160082164 GCACTTTTGGAGACCATGGTGGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
945844624 2:214929458-214929480 GCACTTTGGGAGACCATGGATGG + Intergenic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
946434774 2:219644240-219644262 ACACTCAGGGGGACCATGGAGGG + Intergenic
1169771536 20:9206789-9206811 AGAGTTCTGGATACAATGGATGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171159755 20:22910539-22910561 TCACTTAAGGAGAGAATGGGAGG + Intergenic
1171788839 20:29499247-29499269 AAACTGATGGTGACAATAGAAGG - Intergenic
1176157428 20:63628600-63628622 ACACTTTGGGAGACAAAGGTGGG + Intergenic
1178035493 21:28578021-28578043 AAATTAATGGAAACAATGGAAGG - Intergenic
1181309133 22:21934224-21934246 GCACTGATGGGCACAATGGAGGG + Exonic
1182498573 22:30728741-30728763 ACACTTTGGGAGACCATGGCAGG - Intronic
950135121 3:10575554-10575576 ACACTTATGGGAGCTATGGAAGG + Intronic
950833238 3:15895778-15895800 ACACTTTAGGAGACAAAGGCAGG - Intergenic
952105270 3:30062792-30062814 ACATTTATTGAGTCAATGGAGGG - Intergenic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
953221016 3:40971588-40971610 ACACTTGTGGATACAAAGGAGGG + Intergenic
953453194 3:43021062-43021084 ACCCTTGTGGAGGCAATGGCAGG + Intronic
955343587 3:58144336-58144358 ACACTTTAGGAGACAAAGGCGGG - Intronic
955492948 3:59501424-59501446 AGACTGATGGAGGCAGTGGAAGG + Intergenic
956444180 3:69309386-69309408 ACACTTTTGGAGACCAAGGGAGG - Intronic
957233007 3:77545234-77545256 ACACTTTTGGCTACAAAGGAGGG - Intronic
958795789 3:98704869-98704891 ACACTTCTTGGGTCAATGGACGG - Intergenic
961108459 3:124262502-124262524 ACACTTATTGAAACAATGAGTGG - Intronic
962017885 3:131461857-131461879 ACACTTTGGGAGGCCATGGAAGG + Intergenic
963943638 3:151120659-151120681 CCACATAAGGAAACAATGGAAGG + Intronic
964949912 3:162277502-162277524 ACACTTTTGGGGCCAAGGGAGGG - Intergenic
965274683 3:166666206-166666228 ACACTTCTTGAGACAATAAAAGG + Intergenic
966286527 3:178302603-178302625 ACACTTTTGGAGACCAAGGTGGG - Intergenic
968134950 3:196214598-196214620 ACACTTATTGAGACAGAGGAGGG - Intronic
970366992 4:15369789-15369811 ACATTAATGAAGATAATGGAAGG + Intronic
970810288 4:20085569-20085591 ACACTTTTCTAGACAATGGAGGG - Intergenic
971091872 4:23354937-23354959 ACATGCATGGAGATAATGGAGGG - Intergenic
973143897 4:46801518-46801540 ACACTCATGGACACAAAGAAGGG + Intronic
973216447 4:47674613-47674635 ATACTTTTGGAGAAATTGGAAGG - Intronic
975423710 4:74201341-74201363 ACACTGATGGAGAGCATGAACGG + Exonic
975575187 4:75855559-75855581 ACACTTTGGGAGACAAAGGAGGG + Intergenic
977068340 4:92348210-92348232 ACACTTTGGGAGACCAGGGAGGG - Intronic
979853547 4:125603423-125603445 ACAATGATAGAGAAAATGGAAGG + Intergenic
983742598 4:171153779-171153801 ACACTTATTGTGGCTATGGATGG - Intergenic
984369729 4:178847355-178847377 GCACTTAGGGAGACCAAGGAGGG - Intergenic
984716295 4:182928653-182928675 GCACTTCTAGAGAGAATGGAGGG + Intergenic
986093454 5:4533862-4533884 ACACTTCTGGAGACCCTGCAAGG - Intergenic
986113621 5:4747823-4747845 ACACCTTTAGAGACAATGGTGGG - Intergenic
986972017 5:13347938-13347960 ACATGTATGGAGACAATGTGTGG + Intergenic
988698064 5:33643997-33644019 ACCCTTATGGGGATAAAGGAAGG + Intronic
990292452 5:54366469-54366491 ACACTTAGGGAGGCCATGGCGGG + Intergenic
990457757 5:56004629-56004651 TCACTAAGGGAGATAATGGAGGG + Intergenic
991070570 5:62475151-62475173 ACACTTTGGGAGACAAAGGTGGG - Intronic
993169175 5:84394913-84394935 AGTCTTATGGAGGAAATGGATGG + Intergenic
995261135 5:110105878-110105900 ACACTCATAGAGACCATGCAAGG + Intergenic
995407375 5:111814463-111814485 AAAGTTACGGAGGCAATGGAGGG - Intronic
997241472 5:132311482-132311504 ACACTTCTGGAAAGACTGGATGG + Intronic
999788574 5:154914689-154914711 ACACTTGAGGAGACCATGGCAGG - Intronic
1000821567 5:165990835-165990857 ACACATATGGACACAAAGAAGGG - Intergenic
1002308208 5:178296710-178296732 ACCCCTCTGGAGACCATGGATGG - Intronic
1005523331 6:26620355-26620377 ACACTTTGGGAGACAAAGGCAGG - Intergenic
1006283614 6:33076619-33076641 ACAATTAAGGAGAGAAGGGAGGG + Intronic
1008783235 6:55133322-55133344 ACATTTATGGAAACAAAGCAAGG - Intronic
1008803925 6:55404913-55404935 ACACTGATAGAAACAATTGAAGG - Intergenic
1008821476 6:55636950-55636972 ACACTTATTTAGACTTTGGAGGG - Intergenic
1011012141 6:82714670-82714692 ACACTCATGGAGAAAATTGATGG + Intergenic
1011865883 6:91826385-91826407 AAAATTATGAAGACAATGGGAGG - Intergenic
1012708806 6:102571276-102571298 ATAACTATAGAGACAATGGAAGG + Intergenic
1014399371 6:120968075-120968097 ACACTTATGAAGTGACTGGAAGG + Intergenic
1015501747 6:133941405-133941427 AATCTTGTGGAGACAATAGAGGG + Intergenic
1016724009 6:147339154-147339176 ACACAAATGAAGACAACGGAAGG - Intronic
1017466004 6:154694379-154694401 ACACTTTAGGAGACTAAGGAAGG - Intergenic
1018803674 6:167242243-167242265 ACACGTATGGACACAGTGCAGGG - Intergenic
1018806537 6:167266259-167266281 ACACGTATGGACACAGTGCAGGG + Intergenic
1020718425 7:11709500-11709522 TAACTCATGGAGATAATGGAAGG + Intronic
1024003872 7:45211243-45211265 ACATCTCAGGAGACAATGGAGGG - Intergenic
1027416989 7:77984056-77984078 ACACATGTGGAGATAACGGAAGG + Intergenic
1027600006 7:80228264-80228286 ACACATATAGAGAAAATGTAAGG - Intergenic
1029734722 7:102459281-102459303 ACACGGATGGTGACAATGGGAGG + Intronic
1030322023 7:108179209-108179231 TCCCTTAGGGAGACAATGAATGG - Intronic
1030438023 7:109550975-109550997 ACATTTTTCTAGACAATGGATGG - Intergenic
1031031454 7:116740006-116740028 TCACTTCTGGAGACACTGGATGG - Exonic
1031332790 7:120486740-120486762 ACAGTAATTGAGACAATGCAAGG + Intronic
1040012412 8:42673167-42673189 ACACTTTGGGAGACCAAGGAGGG - Intergenic
1041230404 8:55745165-55745187 ACTCTAATGGAGACATTGAATGG - Intronic
1041778788 8:61554958-61554980 ACACTTTTGGAGACCAAGGTGGG - Intronic
1042656875 8:71108846-71108868 ACACATATGGTGCCAATGGCAGG - Intergenic
1045421485 8:102020982-102021004 ACACTTAAGTGGAGAATGGAAGG - Intronic
1046054939 8:109068054-109068076 AAACCTATGGAGATAATTGAAGG - Intergenic
1046265009 8:111819261-111819283 ACACTGATGGAGGAATTGGAAGG + Intergenic
1046739107 8:117809808-117809830 ATACTAATGGAGACAACTGATGG + Intronic
1048278970 8:133090676-133090698 AGATTAAAGGAGACAATGGAGGG - Intronic
1049092193 8:140524668-140524690 GCACTGATGGAGACAGAGGAAGG + Intergenic
1049095129 8:140544205-140544227 ACACTCACGGCGGCAATGGAGGG + Exonic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1050776591 9:9270499-9270521 ACAGTCAAGGAAACAATGGAAGG + Intronic
1050783140 9:9364638-9364660 AAAGTTATGGAGGCAATGGAGGG + Intronic
1051595549 9:18821365-18821387 ACCCCTATGGAGACCTTGGAAGG - Intronic
1051906846 9:22105212-22105234 GCACATATGAAGACTATGGAGGG + Intergenic
1052723149 9:32197056-32197078 ACACTGATGAAAAAAATGGAAGG - Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1053891949 9:42702797-42702819 GCACTTTTGGAGACCAAGGAGGG - Intergenic
1055668193 9:78573205-78573227 ACAAATAAGGAGACAAAGGAAGG - Intergenic
1058051545 9:100411563-100411585 AGACTTCTGGAGTAAATGGAGGG + Intergenic
1060027418 9:120184907-120184929 ACATTCATGAAGACAATAGATGG - Intergenic
1061374917 9:130218363-130218385 ACACATATGCACACAATGCATGG + Intronic
1185744866 X:2564513-2564535 ACACTTTGGGAGGCCATGGAGGG - Intergenic
1187585575 X:20657725-20657747 ACACTTTTGGTGACAGTGTAAGG + Intergenic
1190430750 X:50375889-50375911 AAACTGATGGAGAGAGTGGACGG - Intronic
1193009099 X:76656005-76656027 ACATTTTTGCAGTCAATGGAAGG - Intergenic
1193652940 X:84160872-84160894 AAAATTATGTACACAATGGAAGG + Intronic
1193700461 X:84754295-84754317 AAAATTATGGAAACAATGAAAGG - Intergenic
1196809335 X:119616152-119616174 ACACTTAGGTAGAGAAGGGAGGG - Intronic
1199012332 X:142771972-142771994 ACAATTTTGGAGTCAAAGGAGGG - Intergenic
1199406630 X:147469514-147469536 ACATTTTTGAAGAAAATGGAAGG - Intergenic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic