ID: 1200290104

View in Genome Browser
Species Human (GRCh38)
Location X:154863667-154863689
Sequence ATGGACAAAAGTGTCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 8, 2: 24, 3: 38, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200290098_1200290104 9 Left 1200290098 X:154863635-154863657 CCCCCACAGGAACAATAATTTGA 0: 1
1: 0
2: 3
3: 55
4: 391
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219
1200290100_1200290104 7 Left 1200290100 X:154863637-154863659 CCCACAGGAACAATAATTTGACA 0: 1
1: 0
2: 4
3: 35
4: 279
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219
1200290096_1200290104 22 Left 1200290096 X:154863622-154863644 CCTAGCTCTTGTTCCCCCACAGG 0: 1
1: 0
2: 4
3: 23
4: 233
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219
1200290095_1200290104 23 Left 1200290095 X:154863621-154863643 CCCTAGCTCTTGTTCCCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219
1200290101_1200290104 6 Left 1200290101 X:154863638-154863660 CCACAGGAACAATAATTTGACAA 0: 1
1: 0
2: 2
3: 26
4: 280
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219
1200290099_1200290104 8 Left 1200290099 X:154863636-154863658 CCCCACAGGAACAATAATTTGAC 0: 1
1: 0
2: 4
3: 32
4: 274
Right 1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG 0: 1
1: 8
2: 24
3: 38
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200290104 Original CRISPR ATGGACAAAAGTGTCTTTGT GGG Intronic
900469368 1:2845587-2845609 TTGGAAAAAAGGGTCTTTGCAGG - Intergenic
901900345 1:12356243-12356265 ATGCTCAAAACTGTCTTTTTAGG + Intronic
902912223 1:19608220-19608242 ATGGACAAAAGTGTCATTGAAGG - Intronic
903083912 1:20837650-20837672 AAGGACAATACTATCTTTGTAGG + Intronic
903250638 1:22050968-22050990 CTGGAATTAAGTGTCTTTGTTGG + Intergenic
905439039 1:37981529-37981551 GTGGACAAAGGTGTGTCTGTGGG - Intronic
916481878 1:165221544-165221566 TTGAACAAAGGTGTCTTTCTTGG - Intronic
916751135 1:167723489-167723511 AAGGTTAAAAGTGTGTTTGTTGG + Intronic
916803590 1:168237265-168237287 ATGGAAAAACGTGTGTCTGTGGG + Intronic
917114655 1:171590579-171590601 ATTGATTAAAGTGTCTTTTTGGG + Intronic
917782331 1:178411665-178411687 ATGGACAAAAGTGTCACTGAAGG - Intronic
918219538 1:182424099-182424121 ATGCACAAAAGTGTCAATCTGGG - Intergenic
918613086 1:186513912-186513934 ATGGTCAAAAGTGTCTCTGCAGG - Intergenic
919305206 1:195823525-195823547 ATGGACTAAAGTGTCATTGTGGG - Intergenic
920530193 1:206696141-206696163 ATGGACAAAAGTGTCATTGAAGG + Intronic
921978778 1:221231962-221231984 ATGAACAAAAGTATTTTTTTAGG - Intergenic
922096138 1:222444622-222444644 TTGGACAAAAGTGTCTGTGGTGG - Intergenic
923299236 1:232625965-232625987 AAAGAAAAAAGTGTCTGTGTGGG + Intergenic
924356273 1:243179587-243179609 ATGCAGAAAAATTTCTTTGTGGG + Intronic
1063027537 10:2196141-2196163 ATGGAAAGAAGTGTTTTTGGAGG - Intergenic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1065847496 10:29758108-29758130 ATGGACAAATGAGTCACTGTGGG - Intergenic
1066217948 10:33306193-33306215 ATGAACAGAAGTGTTTTTGCAGG - Intronic
1066493587 10:35918791-35918813 ATGTACAAAAATGTGTGTGTAGG - Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1069009877 10:63360588-63360610 ATGAACAAAAATGTTTGTGTTGG - Intronic
1071989933 10:91091845-91091867 ATGTACATATGTGCCTTTGTGGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1072910487 10:99496669-99496691 ATGGGCAAAGGGGTCTTTGCAGG + Intergenic
1073870395 10:107856696-107856718 ATGTTCAAAAGTGTCTTTTAGGG - Intergenic
1074723956 10:116288518-116288540 ATGGACAAATGTGTTTTGTTTGG + Intergenic
1076718632 10:132382279-132382301 ATGGACAGAAGTGTCAGTGCTGG + Intergenic
1078534840 11:12164580-12164602 ATGGAGAAAAATGTGTTTGCAGG - Intronic
1083131838 11:60632326-60632348 CTGCACAAAAGTGTCTGTATGGG - Intergenic
1085769998 11:79316446-79316468 ATGGACAAGTGAGTCTGTGTGGG + Intronic
1086081328 11:82905243-82905265 AGGGACAAAAGTGTAAGTGTTGG - Intronic
1086262887 11:84961892-84961914 TTGGACAAAAGTGTTTTAGGAGG - Intronic
1086802840 11:91198733-91198755 ATAGATAAAATTGTCTTTGAAGG - Intergenic
1087132901 11:94684261-94684283 ACGGACAAAAGTCTCCTTGTGGG + Intergenic
1088711947 11:112516282-112516304 GTGGGCACAAGTGTCTGTGTTGG - Intergenic
1089078338 11:115756917-115756939 ATGGACAAATGTGTTTCTTTAGG - Intergenic
1089920920 11:122208918-122208940 ATGGACAAGAGGGTCTCTGGTGG + Intergenic
1090071222 11:123546225-123546247 ATGGACAGAAGTGTCTGTGGGGG + Intronic
1091716734 12:2783057-2783079 ATGGGCACAAGTTTCTTTCTGGG + Intergenic
1092819328 12:12338649-12338671 ATGAACAAAGGTGTTTGTGTTGG - Intronic
1093733885 12:22596541-22596563 ATGGACACATGTGACTTTGAAGG + Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1097358574 12:58631372-58631394 ACAAACAAAAGTCTCTTTGTGGG + Intronic
1097706786 12:62877011-62877033 TTGGGCAACAGTGTGTTTGTAGG - Intronic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1099644874 12:85340160-85340182 ATGAAAAAAAGTGACTTTTTGGG + Intergenic
1101156720 12:101934644-101934666 ATGGACAAGAGTTTCTGTTTGGG + Intronic
1101527784 12:105547510-105547532 ATGGACCATGGTGTCTTTGTTGG + Intergenic
1101872933 12:108580637-108580659 ATGGAGATAAATGTCTTTCTTGG - Intergenic
1102230905 12:111261568-111261590 ATGGACAAGAGTGAGTTTCTGGG - Intronic
1103267498 12:119643380-119643402 AAGGACAAAATGGTTTTTGTTGG + Intergenic
1106659724 13:31785939-31785961 GTGGACAATATTGTCTTGGTTGG + Intronic
1107284856 13:38779593-38779615 ATGGAGAGAAATGTCTTTGCTGG - Intronic
1107600472 13:42007243-42007265 TTGGCCAAAAGTCTCCTTGTCGG - Intergenic
1108286339 13:48912459-48912481 ATGAACAAAAGTGTCCTTCCAGG + Intergenic
1108567909 13:51719359-51719381 CTGGACAAAAATCTCTTAGTGGG + Intronic
1109344440 13:61098449-61098471 ATGGATAAAATGGTCTTTCTAGG - Intergenic
1110937941 13:81316779-81316801 AGGGCCAAAAGTGTTTTTTTGGG - Intergenic
1111419558 13:87994479-87994501 ATAGACAATAGTGTCTTGGAAGG - Intergenic
1113056610 13:106274907-106274929 ATGGAAAAAAGTATCTTTAATGG - Intergenic
1113234140 13:108250922-108250944 ATAGACAAAGGTTTCTTTTTGGG + Intergenic
1114305309 14:21418031-21418053 ATATACAAACGTGACTTTGTAGG - Intronic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1122321695 14:100859396-100859418 CTGGACCAACATGTCTTTGTTGG + Intergenic
1123104886 14:105836769-105836791 ATGAACCAAAGTGTGTTTATGGG + Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1126286432 15:47018335-47018357 ACAGACAAAAATCTCTTTGTGGG + Intergenic
1126924812 15:53572598-53572620 ATGAAAAAAAATTTCTTTGTGGG + Intronic
1127662126 15:61109919-61109941 ATTGACCAAAATGTCTTTATGGG - Intronic
1129221140 15:74132352-74132374 ACGGACAAAAATGTCCTTCTTGG + Intronic
1129831635 15:78674763-78674785 TTGGGGAAAAGGGTCTTTGTAGG + Intronic
1130680676 15:85993508-85993530 ATGCACAAGAGTGTCATTATGGG + Intergenic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1130977325 15:88787473-88787495 TTTGAAAAAAGTGTCTTTGCAGG - Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1132977679 16:2718853-2718875 ATGGACACAAGTGTGGCTGTGGG + Intronic
1133722500 16:8508175-8508197 ATGGACCAAAGTGTCAGTGAAGG - Intergenic
1133857276 16:9561327-9561349 TTTGACAAAAGTCTCTTTCTGGG + Intergenic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1134863492 16:17583226-17583248 ATGATCAAAATTGTTTTTGTAGG + Intergenic
1137799224 16:51247315-51247337 ATGGACAAGGGTGTCTTTCCTGG + Intergenic
1141871242 16:86788255-86788277 ATGGGCACAAGTTTCCTTGTGGG - Intergenic
1147481038 17:40762834-40762856 ACAGGCAAAAGTGCCTTTGTAGG - Intergenic
1148053860 17:44782032-44782054 AGGGGCACAACTGTCTTTGTTGG - Intergenic
1148987252 17:51633776-51633798 ATGGAAAAAAGGGACTCTGTGGG - Intronic
1150537348 17:66056756-66056778 ATGGATAAAGGTTTCTTTCTAGG + Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1151379509 17:73715723-73715745 AGAGACAAAATTGTCTTTGGGGG - Intergenic
1153084663 18:1270896-1270918 ATAGAAGATAGTGTCTTTGTAGG + Intergenic
1156488845 18:37484835-37484857 ATGGAAAGATGTGTGTTTGTGGG - Intronic
1157259765 18:46167824-46167846 GTGGAGAGAAGTGACTTTGTGGG - Intergenic
1158377674 18:56889337-56889359 TTGGACAAAAATGTCTTTCAGGG - Intronic
1158580184 18:58674010-58674032 ATGTAAAAAATTGTCTTTGGGGG + Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159809667 18:73002644-73002666 ATGGACAATCTTGTCTTTGCGGG + Intergenic
1159843037 18:73423068-73423090 TTGTACAAAAGTGTCTTTTTAGG + Intergenic
1162878326 19:13637697-13637719 ACAAACAAAAATGTCTTTGTGGG + Intergenic
1167869170 19:52353359-52353381 ATGGACAAAAGTGTATTTATAGG + Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
1168590668 19:57632032-57632054 ATGAACAAAACTGACTTTGCAGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
926692770 2:15748565-15748587 TTGGACACAAGGGTCTTTGAAGG + Intergenic
928816637 2:35303411-35303433 AAGGACAAAAGGGTTTTAGTTGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
929716414 2:44315241-44315263 TTAGAAAAAAGTGTCATTGTTGG - Intronic
931148626 2:59547638-59547660 ATGGAAAAAAGTGGCTTGCTAGG + Intergenic
932082615 2:68729039-68729061 ATGGACAAAGGTGTCTGTTCTGG - Intronic
933350583 2:81147304-81147326 ATGTACAAAAGGGTCTTCGTGGG - Intergenic
933994057 2:87654996-87655018 ATGGACAAATGTGTCATTGAAGG - Intergenic
935704703 2:105845873-105845895 ATGGACATAGATGTCTTTGGTGG - Intronic
936299807 2:111295918-111295940 ATGGACAAATGTGTCATTGAAGG + Intergenic
937411319 2:121679001-121679023 AGGGACTAGATTGTCTTTGTAGG + Intergenic
939377029 2:141381891-141381913 ACAGACTAAAGTCTCTTTGTGGG + Intronic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
940459503 2:153946135-153946157 ATGTAGAAAAGTGTTTTTGATGG + Intronic
941972023 2:171361166-171361188 CTGCACAAAAATGTCTTTCTTGG + Intronic
943348388 2:186769114-186769136 AAAGGCAAAAGTGGCTTTGTGGG + Intergenic
946882390 2:224189566-224189588 ATGGAAATAAGTTTCTGTGTTGG + Intergenic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169721055 20:8676826-8676848 AGGGAAAAAAGTAACTTTGTAGG + Intronic
1175614838 20:60389083-60389105 ATGGATACAGGTTTCTTTGTGGG + Intergenic
1176980923 21:15380055-15380077 TAAGACAAAAGTGGCTTTGTAGG + Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177886315 21:26750125-26750147 TTGGTCAGAACTGTCTTTGTAGG + Intergenic
1181854967 22:25774940-25774962 ATGCACAGAAGTGTGCTTGTAGG - Intronic
951072777 3:18351722-18351744 TTTGGCAAATGTGTCTTTGTTGG - Intronic
951181275 3:19661986-19662008 ATGAAAAAAAAAGTCTTTGTGGG + Intergenic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
952622962 3:35368053-35368075 ATGGACAAAAGCATCCTTGCAGG - Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
956967561 3:74479745-74479767 AGGAACAAAATTGTCTTTCTGGG - Intronic
958777147 3:98499464-98499486 ATGTAAAAAAGTGTGATTGTGGG + Intronic
959816951 3:110684824-110684846 AAGGACAAAACTGACTTTTTCGG - Intergenic
960114207 3:113877280-113877302 ATATAGAAAAATGTCTTTGTTGG - Intronic
963363528 3:144305495-144305517 ACAGACAAAAGTCTCTCTGTGGG - Intergenic
963471759 3:145750096-145750118 CTGGACAAAAGGTTTTTTGTTGG - Intergenic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
964945061 3:162211577-162211599 AGGGAAAACAGAGTCTTTGTTGG - Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
972512917 4:39786338-39786360 AAGGATAAAAGTGCCTATGTGGG + Intergenic
973235515 4:47898990-47899012 GTGGACAGAAGTTGCTTTGTGGG - Exonic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
976336802 4:83897562-83897584 ATGGTCAAAAATTTCTTTCTTGG + Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
978082154 4:104606400-104606422 ATAGACAAAAGCATCTCTGTAGG - Intergenic
978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG + Intronic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979245543 4:118500044-118500066 ATGCAGAAAAATTTCTTTGTGGG - Intergenic
979568199 4:122181376-122181398 ATGGACCAAAGTCTGTCTGTAGG - Intronic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
979869142 4:125794704-125794726 ATGGGCAAAATTGGCTTGGTTGG + Intergenic
980626611 4:135381436-135381458 AGGGACTAAACTGCCTTTGTAGG + Intergenic
980813180 4:137910276-137910298 GTGGAGAAAAGTGGCTTAGTTGG - Intergenic
982166009 4:152614206-152614228 ATGGACAAAGGTGTCATTGAAGG + Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
982888625 4:160818523-160818545 ATGGACAGAAGTGTCACTGAAGG - Intergenic
986135460 5:4973541-4973563 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986135470 5:4973607-4973629 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986747172 5:10754871-10754893 ATGGGGAAAAGTGACTTTGGTGG + Intronic
987886032 5:23814234-23814256 AAGAACAAAAGTGTCTTAATTGG + Intergenic
988167278 5:27610143-27610165 GTGGAAAAAAATGTCTTTTTAGG + Intergenic
989310324 5:40009213-40009235 ATGGATAAAAGTACCATTGTGGG - Intergenic
989365667 5:40652756-40652778 CTGTACAAAAGAGTCTGTGTGGG - Intergenic
990481413 5:56214915-56214937 ATGGATAAAAGTGTCAATCTGGG + Intronic
991291543 5:65037728-65037750 ATGGAGAAAACTGGCTTGGTTGG - Intergenic
992042013 5:72844493-72844515 ATAGATAAAATTGTCTTTGAAGG + Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993459444 5:88165199-88165221 ATGGACAAGAGTATTGTTGTTGG + Intergenic
993586130 5:89730900-89730922 AATGACAAAAATGTCTTTATAGG - Intergenic
993862017 5:93147761-93147783 ATGATCAAAATTCTCTTTGTTGG - Intergenic
994401402 5:99284976-99284998 ATGGACAAAAGTATATTAGCTGG - Intergenic
995852684 5:116562665-116562687 ATGGACAAAAGTGTCATTGAAGG - Intronic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
999294140 5:150447605-150447627 ATGGACAAAAGTGTCATTGAAGG + Exonic
999879879 5:155850526-155850548 ATGATCAAAAGTGACATTGTGGG + Intergenic
1000171929 5:158711027-158711049 ATGTACCAAAATGTTTTTGTAGG + Intronic
1000670204 5:164052268-164052290 ATGTTAAAAAGTATCTTTGTGGG - Intergenic
1001458621 5:171888220-171888242 AAGGAAAAAAGTGTCCTTATGGG + Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003246977 6:4390694-4390716 ATAGACAAAAATGTTTTTCTAGG + Intergenic
1003580082 6:7332131-7332153 ATGGACACCACTGTCTTTGGAGG + Intronic
1003703248 6:8494367-8494389 ATGCAGAAAAGTGAATTTGTGGG - Intergenic
1004139954 6:13009217-13009239 TTTGGCAAAAGTGTCTTTGCAGG - Intronic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1009010536 6:57837124-57837146 GAGGACAAAAAGGTCTTTGTGGG - Intergenic
1010464990 6:76157296-76157318 ATGGACAAAGGTGACTTGGGGGG - Intergenic
1011411246 6:87068907-87068929 ATGGACAGATGTGACTTTGAAGG - Intergenic
1011525949 6:88265183-88265205 ATGGACAAAGGTGTCAGTGAAGG - Intergenic
1012632986 6:101496683-101496705 ATGGACAAACATGTATTTTTGGG + Intronic
1014511901 6:122332831-122332853 AGAGATAAAAGAGTCTTTGTAGG + Intergenic
1014759633 6:125342367-125342389 ATGAACAAAGATGTCTTTGGGGG + Intergenic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1015019034 6:128449438-128449460 CTGGAAAAAAGTGTCCTTCTAGG - Intronic
1015976036 6:138791815-138791837 TTGGACAAGAATGTCTTTGATGG + Intronic
1016761716 6:147745349-147745371 ATGGAAAAAAATGTCTTTACTGG + Intergenic
1017341288 6:153325127-153325149 ATGTTCATCAGTGTCTTTGTAGG + Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018268068 6:162046775-162046797 ATGGAAAAAAGTGTCAATGATGG - Intronic
1019726005 7:2603058-2603080 ATGGACAAGGGTGTGTCTGTGGG - Intronic
1020840254 7:13208807-13208829 AAAGACAAAAGTGCCTTTCTGGG - Intergenic
1020957039 7:14752766-14752788 GTGGAGAAAGGTGTGTTTGTTGG + Intronic
1021629844 7:22633847-22633869 ACGGAAAAAAGAGTCTTTTTGGG + Intergenic
1021944643 7:25714804-25714826 ATTCAGCAAAGTGTCTTTGTTGG - Intergenic
1022071465 7:26919558-26919580 ATGTCCAACAGTTTCTTTGTGGG - Intronic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1026367016 7:69658749-69658771 ATAGACATCAGTATCTTTGTAGG + Intronic
1027364647 7:77444888-77444910 ATAGAAAAAACTGTCATTGTTGG - Intergenic
1027790271 7:82632765-82632787 ATTCACAAAAGTCTATTTGTTGG + Intergenic
1028897428 7:96057955-96057977 ATGGACTGAGGTGTCTTTGTAGG - Intronic
1029318565 7:99736723-99736745 ATGGGAAAAGGTGTCTTTCTGGG - Intergenic
1029323494 7:99785709-99785731 ATGGGAAAAGGTGTCTTTCTGGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1030790156 7:113715712-113715734 AGCAACAAAAATGTCTTTGTAGG - Intergenic
1036677642 8:10848472-10848494 ATGGACATAAGTGTCTTGCCTGG + Intergenic
1037662883 8:20942210-20942232 TTGGACCAAAGTGCCTTGGTTGG - Intergenic
1037987370 8:23298431-23298453 AAGGAAAAAAGTGTCTTTATTGG + Intronic
1039222220 8:35345128-35345150 ATGGAGAAAAGTGTATTTTTAGG - Intronic
1042330155 8:67570813-67570835 ATGAACAAAATGGTATTTGTAGG + Intronic
1042691566 8:71505430-71505452 TTTCACAAAAGTGTTTTTGTTGG - Intronic
1042869717 8:73387203-73387225 GTAGATGAAAGTGTCTTTGTGGG + Intergenic
1043885008 8:85588855-85588877 AGGGACAAAACTAGCTTTGTGGG - Intergenic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1046697365 8:117357093-117357115 TTGGAAAAAAGGGTCTTTGCAGG - Intergenic
1047599331 8:126410558-126410580 ATGATCAAAAATGTGTTTGTAGG + Intergenic
1049777241 8:144412417-144412439 AAGGACAAGAGTGTCTTTACTGG + Exonic
1050126146 9:2358101-2358123 AGGGACAACAGGGTCTATGTGGG + Intergenic
1050829454 9:9992120-9992142 ATGGGTAAAAGTTTCTTTCTTGG + Intronic
1051045777 9:12871900-12871922 ATAGACAAAAATGTTATTGTGGG + Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1056213959 9:84391042-84391064 AGGGACTAGATTGTCTTTGTAGG - Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1057428185 9:94971164-94971186 AACAACAAAAGTCTCTTTGTGGG - Intronic
1058226184 9:102366946-102366968 ATGTACAAAATTATCTTTGGGGG + Intergenic
1058568493 9:106313251-106313273 ATGGAAAAAACTGTTTTTGATGG + Intergenic
1060285826 9:122251437-122251459 AATAACAAAAGAGTCTTTGTGGG + Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1185823005 X:3222633-3222655 ATGAGCACAAGTGTTTTTGTAGG + Intergenic
1186036702 X:5430534-5430556 ATGGCCAATAGTGTCGGTGTGGG + Intergenic
1186042034 X:5491192-5491214 ATGCACATAATTTTCTTTGTAGG - Intergenic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187918682 X:24179791-24179813 ATTGTCAAAGGTGTTTTTGTAGG + Intronic
1188049665 X:25469184-25469206 ATGGAAAGTAGTGGCTTTGTAGG + Intergenic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190870397 X:54420198-54420220 AGGGCCAGAAGTGGCTTTGTAGG + Intergenic
1190888031 X:54546389-54546411 ATGGGCAAGTGTGTGTTTGTAGG + Intronic
1191573783 X:62669926-62669948 TTGGAAAAAAGTCTTTTTGTAGG + Intergenic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1195128083 X:101828649-101828671 ATGAACAACAGTGTATTTTTTGG + Intergenic
1195614985 X:106905062-106905084 ATGGATAAACATTTCTTTGTTGG - Intronic
1196649069 X:118150342-118150364 GTGGACTAGACTGTCTTTGTAGG + Intergenic
1196705447 X:118713467-118713489 ATGGGCACAAGTGTTTTTGGGGG - Intergenic
1196916711 X:120543809-120543831 ATGTAAAAAACTATCTTTGTAGG - Exonic
1197209639 X:123818214-123818236 GTGGACTAGACTGTCTTTGTAGG - Intergenic
1198551612 X:137751226-137751248 AGGTAAAAAAGTTTCTTTGTTGG + Intergenic
1198731917 X:139740612-139740634 ATGGACAATAATGTATCTGTTGG + Intronic
1199200416 X:145081183-145081205 ATGGACAAAAGTGGCTGAGTTGG - Intergenic
1199265316 X:145820964-145820986 ATGCACCAATGTGTCTGTGTAGG - Exonic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1199380810 X:147169975-147169997 ATGGAGCAAAGTGTTTCTGTGGG + Intergenic
1199456307 X:148033212-148033234 ATTGACTTCAGTGTCTTTGTGGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200925769 Y:8653273-8653295 AAGAAGAAAAGTATCTTTGTTGG - Intergenic
1200938967 Y:8762880-8762902 AAGAACAAGAGTTTCTTTGTTGG + Intergenic
1200972009 Y:9162730-9162752 ATAGACAATTCTGTCTTTGTGGG - Intergenic