ID: 1200296931

View in Genome Browser
Species Human (GRCh38)
Location X:154929358-154929380
Sequence GATGACTGGTGATCAAAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200296931_1200296934 -7 Left 1200296931 X:154929358-154929380 CCTCTCTTTGATCACCAGTCATC 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1200296934 X:154929374-154929396 AGTCATCTCCAAGGTTAGAATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1200296931_1200296937 17 Left 1200296931 X:154929358-154929380 CCTCTCTTTGATCACCAGTCATC 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1200296937 X:154929398-154929420 TAAAGAAAGGTTATTTTTTTTGG 0: 1
1: 1
2: 5
3: 72
4: 864
1200296931_1200296936 4 Left 1200296931 X:154929358-154929380 CCTCTCTTTGATCACCAGTCATC 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1200296936 X:154929385-154929407 AGGTTAGAATGGCTAAAGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200296931 Original CRISPR GATGACTGGTGATCAAAGAG AGG (reversed) Exonic
907116980 1:51977540-51977562 GAGGCCCGGTGATCAAGGAGAGG + Intronic
908427522 1:64022009-64022031 GATGACTGGTAAACAAAGAGTGG + Intronic
910467874 1:87519361-87519383 GAAGACTGCTGAACAAAGACAGG + Intergenic
917059827 1:171025137-171025159 GATGAATGCTAATCAAAGAATGG + Intronic
918381874 1:183964016-183964038 GATGCCTGAGGATCCAAGAGAGG + Exonic
922864374 1:228847115-228847137 GGAGACTGGTGATGAAAGATTGG - Intergenic
923264443 1:232300772-232300794 AAAGACTGGTGATCAATCAGAGG + Intergenic
1062792550 10:318173-318195 GATGTATGGTGACCAAAGTGTGG - Intronic
1065746947 10:28850883-28850905 GAAGACTGGTTATTAAAGGGAGG - Intronic
1066195372 10:33093915-33093937 AATGACTTGTTAACAAAGAGAGG - Intergenic
1069139240 10:64803092-64803114 GCTGACTGGTATTCAAAGAATGG + Intergenic
1069708714 10:70475598-70475620 GATGAATCTTGATCAAAGATGGG - Intergenic
1071396598 10:85229729-85229751 CATTACTGGTGAGAAAAGAGAGG - Intergenic
1071853331 10:89598217-89598239 CATGACTTGTGATAAATGAGTGG - Intronic
1074418243 10:113286178-113286200 GATGTCTGGTGACGAGAGAGAGG - Intergenic
1076478303 10:130767653-130767675 GGTCACTGGTGCTCAGAGAGGGG - Intergenic
1078682892 11:13496844-13496866 GAAGACTGGAGTTCAAAGAAGGG - Intergenic
1082751731 11:57026226-57026248 TATGACTTGTGATCAATAAGAGG - Intergenic
1085690348 11:78659179-78659201 GATCACTGGTGGCCTAAGAGAGG + Intronic
1086419709 11:86626732-86626754 TATGACTGGTGAGCTAAGAATGG - Intronic
1089887638 11:121843418-121843440 GATGCCTGGAAATCCAAGAGTGG + Intergenic
1091134993 11:133180418-133180440 GGTGAGTGGTGATGAAAGGGAGG - Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1094233466 12:28135976-28135998 AATGACTGGTAACCAAGGAGGGG + Intronic
1095365266 12:41396015-41396037 AATGACTGGTAAACAAACAGAGG - Intronic
1096216518 12:49800847-49800869 AATGACTGCTGATAACAGAGGGG - Intronic
1099404130 12:82238954-82238976 GATGCCTGGGGATTAAATAGAGG - Intronic
1100756899 12:97761212-97761234 AATGACTAGTGAGTAAAGAGGGG - Intergenic
1101345006 12:103878690-103878712 GAAGACTGTGGATCAGAGAGGGG - Intergenic
1102595657 12:113990801-113990823 GCTGACGGGTGATCAAAGATGGG + Intergenic
1104177064 12:126343093-126343115 GAGGACTGGTGCTCAAAGCTGGG + Intergenic
1104936996 12:132370665-132370687 GATGACTGATGAAGAAAGTGTGG - Intergenic
1107471885 13:40698771-40698793 CATGACTGGGGCTCAGAGAGAGG + Intergenic
1107646142 13:42496119-42496141 GATGACTTTTGAGCAAAGACTGG - Intergenic
1115397180 14:32921481-32921503 GATCAGTGGTTCTCAAAGAGTGG - Intergenic
1120685007 14:87528066-87528088 AATGAATGCTGAGCAAAGAGAGG + Intergenic
1120692591 14:87609275-87609297 GATGATTGGGGTTCAAGGAGGGG + Intergenic
1122220678 14:100237929-100237951 GCTGACTGGAGAGCAAAGAAGGG + Intergenic
1122338712 14:101010350-101010372 GATGATAGGTGATCAAAGATGGG + Intergenic
1126175380 15:45730798-45730820 GGTGACAGGAGATCCAAGAGAGG + Intergenic
1127965129 15:63917651-63917673 GTTGAATGGAGATTAAAGAGAGG - Intronic
1137064505 16:35825997-35826019 GATCACTGGTCATCAGAGAAAGG - Intergenic
1138686524 16:58730920-58730942 ATTGACTGGTCATCCAAGAGAGG + Intronic
1144112217 17:12046648-12046670 AATAACTGGAGATCAGAGAGGGG + Intronic
1144274749 17:13655560-13655582 GATGAATGGATATCAAAGTGAGG - Intergenic
1145823289 17:27857233-27857255 GATGACAGAGGATGAAAGAGAGG + Intronic
1145888267 17:28397431-28397453 GATGACTGGAGACCATGGAGCGG - Exonic
1147367665 17:39970069-39970091 GATGAATGGGGAGGAAAGAGGGG + Intronic
1147367683 17:39970121-39970143 GATGAATGGGGAGGAAAGAGGGG + Intronic
1148326580 17:46786533-46786555 GCTGCCTGGTGACCACAGAGGGG + Intronic
1148401756 17:47368543-47368565 GATGACTGCTGTTCAATGTGGGG + Intronic
1149359016 17:55873453-55873475 GATGACTGGTGACTGAAAAGGGG + Intergenic
1151030817 17:70736458-70736480 GATAAGTGGTGACCAAAGAAAGG - Intergenic
1153947268 18:10029027-10029049 GATGACAGGTGAACCAAGTGAGG + Intergenic
1157244133 18:46038731-46038753 GAGGACGGGTGAACCAAGAGAGG - Intronic
1159051491 18:63424649-63424671 TATTACTGGTGATAAAAGAGGGG - Intergenic
1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG + Intergenic
1159927098 18:74279169-74279191 GATGAGTGATGACCTAAGAGAGG + Intronic
1161787297 19:6334703-6334725 TATGACAGGTGAGCAAACAGAGG - Intergenic
1163100533 19:15093363-15093385 GATGAGTGATGATGAGAGAGGGG - Intergenic
1166712138 19:44944565-44944587 GATGGCTGATGGTTAAAGAGGGG + Intronic
927932721 2:27055513-27055535 GGTGACAGCAGATCAAAGAGAGG + Intronic
928144077 2:28755622-28755644 GATGAGTGGTTCTCAAAGAGGGG + Intronic
928166276 2:28974536-28974558 TATGACTGGAGTTCAAGGAGAGG - Intronic
928500405 2:31887131-31887153 GGTGACTGGTGATTAATGAGTGG + Intronic
929951859 2:46417314-46417336 TATGACTGGTGACTAAAGGGAGG + Intergenic
930145313 2:47996439-47996461 GATAGCTGGTGACCAAAGAGGGG - Intergenic
930277417 2:49329546-49329568 GGTGACAGGTGATCCAAGAAGGG - Intergenic
931206486 2:60150400-60150422 GATGACAGGTGATAGAAAAGTGG - Intergenic
932890702 2:75594776-75594798 GACCCCTGGTAATCAAAGAGAGG - Intergenic
935250888 2:101259441-101259463 GAGAACTGGTGGTCAGAGAGAGG + Intronic
947888208 2:233593086-233593108 AGTGACTGGTGATCACAGACTGG - Intergenic
947894438 2:233656316-233656338 AGTGACTGGTGATCACAGACTGG - Intronic
947997855 2:234543939-234543961 GAGGACTGGTGAATAAATAGAGG - Intergenic
1171018321 20:21561707-21561729 GAAGACTGGGGGACAAAGAGGGG - Intergenic
1172770985 20:37382521-37382543 GATGAACAGTGATCAGAGAGTGG + Intronic
1172964296 20:38823077-38823099 TTTGGCTGGAGATCAAAGAGGGG + Intronic
1173328658 20:42055939-42055961 GATCACTCCTGATCAAAGCGTGG + Intergenic
1175165681 20:57042642-57042664 GATGAGGGGTGGTCAAAGGGTGG - Intergenic
1175596059 20:60233904-60233926 GATGTTTGGTGATCAAGGAAAGG - Intergenic
1177547857 21:22582048-22582070 GATCCCTGGTAATCAAAGAGTGG + Intergenic
1180671356 22:17556147-17556169 GAAGGCTGGTGATGAAGGAGAGG - Intronic
1181034042 22:20161461-20161483 GAGGACAGGGGCTCAAAGAGGGG + Intergenic
1184164528 22:42719995-42720017 GATGACAGGTGATGAAACTGAGG + Intronic
1184750212 22:46481529-46481551 GCTCACTGGTGATCAAAGCCTGG + Intronic
1185191532 22:49439732-49439754 ATTGACTTATGATCAAAGAGTGG + Intronic
950051749 3:9996601-9996623 GTTGACTGGGGATCCAAGAAAGG - Intronic
950059136 3:10054816-10054838 GCTGACTGGGGATCCAAGAAAGG - Intronic
951519904 3:23601787-23601809 GATGACTGGTGATCTGTGAGTGG - Intergenic
951534692 3:23729906-23729928 CATGGCTGGTGATCCAAGGGTGG + Intergenic
952716035 3:36482040-36482062 GATGCTTGGTCATCTAAGAGTGG + Intronic
953308015 3:41848384-41848406 GATGACTGGTGACCAAAAAATGG - Intronic
956584977 3:70854626-70854648 GATGAAAGGAGATCAAAGAGAGG - Intergenic
956944034 3:74198410-74198432 TATCACTGGTGATAAAGGAGAGG + Intergenic
957794687 3:84988094-84988116 GCTGAATGGTGGTCAAAAAGTGG - Intronic
960126985 3:114010450-114010472 AATGTCTGATGATCAAAAAGGGG + Intronic
964119476 3:153167484-153167506 GATCACTGGTTTTCAAAGTGTGG - Intergenic
964220382 3:154337854-154337876 GATTACTGGTGGGCAAAAAGAGG + Exonic
967249540 3:187522681-187522703 GAAAACTGGGAATCAAAGAGAGG - Intergenic
970136020 4:12924923-12924945 AAAGACAGATGATCAAAGAGAGG + Intergenic
971145681 4:23974016-23974038 GATTATTGGAGATCAAAGAGAGG + Intergenic
974351886 4:60759048-60759070 GATTACAGATAATCAAAGAGAGG + Intergenic
977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG + Intergenic
980547181 4:134280746-134280768 GATGACTGGTGATAAGAAATTGG - Intergenic
982027149 4:151262355-151262377 CATGTCTGGAGATCAATGAGGGG - Intronic
984799640 4:183702255-183702277 GATGACTTGAGCTCAAAAAGTGG + Intronic
985298972 4:188467141-188467163 GATAGCTTGTGATCAAAGACTGG + Intergenic
986466573 5:8032306-8032328 GATGAATGGTGAGGAAAGAGAGG + Intergenic
986598849 5:9451154-9451176 GATGTCTGCTGATCTGAGAGAGG - Intronic
989181099 5:38578010-38578032 CATGACTGTTAATCAAACAGTGG + Intronic
996853928 5:127983430-127983452 GATGACTGTTGGTGGAAGAGTGG + Intergenic
998369170 5:141650298-141650320 CATTACTGGTGATATAAGAGAGG + Intronic
998601960 5:143593703-143593725 GATGACTAGTGCTGAAAGATAGG - Intergenic
1000006523 5:157190044-157190066 GAAGACTGTTGATCCAAAAGGGG - Intronic
1001112374 5:168907547-168907569 CATGACTAGTCATCAAAAAGAGG - Intronic
1004480810 6:16017827-16017849 GATGACTTTTGCTCAAAGTGTGG + Intergenic
1005026354 6:21466374-21466396 GAAGAATGGGGATCAATGAGAGG - Intergenic
1006870700 6:37248599-37248621 GAAGACTGAAGCTCAAAGAGAGG - Intronic
1007235111 6:40385246-40385268 GATCTCTGGTTATCAAAGATTGG - Intergenic
1009642078 6:66350710-66350732 GATAAGTGCTGATCAAAGGGGGG + Intergenic
1010792854 6:80084773-80084795 GAACACTGGTTCTCAAAGAGGGG - Intergenic
1014809555 6:125870331-125870353 GATGACTGGAATTCACAGAGAGG - Intronic
1017680842 6:156862379-156862401 GATGAGTGTTGTTCAAGGAGAGG + Intronic
1028292288 7:89080161-89080183 GGTGACAGGTAATCAAAGATTGG + Intronic
1028428904 7:90723488-90723510 CAGGTCTGGTGATCTAAGAGGGG + Intronic
1029892367 7:103944035-103944057 TAGGACTGGAGATCAAACAGGGG + Intronic
1031553035 7:123138080-123138102 GAAGAATGGTGACCAAAGACTGG - Intronic
1032170927 7:129583929-129583951 GATGAGTGTGGATCAAAGACTGG + Intergenic
1032903123 7:136333766-136333788 GATGACTGGGGGTCAGAGAAGGG + Intergenic
1037438140 8:18886361-18886383 GATGACTGGGAATTAAAGAATGG + Intronic
1039059626 8:33563341-33563363 GTTGACTGGTGATCCATTAGCGG - Intronic
1040879274 8:52187693-52187715 GATGAGCTGTGATTAAAGAGAGG + Intronic
1043468653 8:80539604-80539626 TATGACTGGTGAGGAAAGAAAGG - Intergenic
1043992872 8:86777756-86777778 GATGCTTGGTGATCACAGAATGG + Intergenic
1046016456 8:108610970-108610992 GATGAATGGTGCTCAGAGAGTGG + Intronic
1046116623 8:109792307-109792329 GATGCCTTGTTTTCAAAGAGAGG - Intergenic
1046829656 8:118730491-118730513 GATGTCTAGTGAGCCAAGAGAGG - Intergenic
1047374145 8:124280267-124280289 GATGACTGTTGCTTAAAGTGTGG - Intergenic
1048110953 8:131468113-131468135 CATCAATGGTGATCAAACAGTGG + Intergenic
1048374977 8:133815342-133815364 GATTACTGGTGACCAATGATGGG - Intergenic
1048405118 8:134111135-134111157 GATCTCTGATGTTCAAAGAGTGG + Intergenic
1050279670 9:4037069-4037091 GAAAACTGGTGCTCAGAGAGTGG - Intronic
1051737575 9:20217313-20217335 GATGAGTAGTGATCAGAAAGAGG + Intergenic
1056832327 9:89927346-89927368 GCTGACGGGTGATTAAAGTGTGG - Intergenic
1059040009 9:110802626-110802648 GAAAACTGATGATGAAAGAGAGG - Intergenic
1060202560 9:121660078-121660100 CTTGAGTGGTGAGCAAAGAGGGG + Intronic
1060224263 9:121781793-121781815 CAGGACTGCTGACCAAAGAGTGG + Intronic
1062402817 9:136379860-136379882 GATGCCTGGAAATGAAAGAGAGG + Exonic
1188182686 X:27075233-27075255 GATGGCTGGGCATCAGAGAGAGG + Intergenic
1192408257 X:70909046-70909068 GATCACTGGTTATGCAAGAGTGG + Intergenic
1196788484 X:119442903-119442925 CATGACTGGTGCTCAATGAATGG - Intronic
1196788915 X:119446759-119446781 CATGACTGGTGCTCAATGAATGG - Intronic
1197488608 X:127087300-127087322 GTTGACTGATGATCAAATTGAGG + Intergenic
1197540217 X:127750253-127750275 GATGGTTGGTGATGAAAGAATGG - Intergenic
1198574748 X:137997947-137997969 GATGAGTGGGAAGCAAAGAGAGG - Intergenic
1198788136 X:140313591-140313613 GATGAGAGGAGATGAAAGAGAGG + Intergenic
1199542911 X:148977545-148977567 TATGACTGGTTTTCAATGAGAGG - Intronic
1200296931 X:154929358-154929380 GATGACTGGTGATCAAAGAGAGG - Exonic