ID: 1200296965

View in Genome Browser
Species Human (GRCh38)
Location X:154929652-154929674
Sequence ACAGATAGACTACAATGAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200296965_1200296969 -8 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296969 X:154929667-154929689 CTATCTGTGTGAGGGTGCTCGGG 0: 1
1: 1
2: 1
3: 12
4: 129
1200296965_1200296972 22 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296972 X:154929697-154929719 GTTTCATGTTTTTGGACCACTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1200296965_1200296971 14 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296971 X:154929689-154929711 GGTCAAATGTTTCATGTTTTTGG 0: 1
1: 0
2: 3
3: 21
4: 299
1200296965_1200296974 29 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296974 X:154929704-154929726 GTTTTTGGACCACTGGGTTGAGG 0: 1
1: 0
2: 3
3: 9
4: 155
1200296965_1200296968 -9 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296968 X:154929666-154929688 TCTATCTGTGTGAGGGTGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 194
1200296965_1200296973 23 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296973 X:154929698-154929720 TTTCATGTTTTTGGACCACTGGG 0: 1
1: 0
2: 0
3: 34
4: 217
1200296965_1200296970 -7 Left 1200296965 X:154929652-154929674 CCTTCTCATTGTAGTCTATCTGT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1200296970 X:154929668-154929690 TATCTGTGTGAGGGTGCTCGGGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200296965 Original CRISPR ACAGATAGACTACAATGAGA AGG (reversed) Exonic
900881605 1:5385671-5385693 ACAGAGAGACGACCATGTGAGGG - Intergenic
901358367 1:8672976-8672998 ACAGAATGACTAGAATCAGATGG + Intronic
901736331 1:11314604-11314626 ACAGCTACACAACAATGTGAAGG - Intergenic
905096603 1:35477365-35477387 AAATAAAAACTACAATGAGATGG + Intronic
906807268 1:48791366-48791388 ATAGATAGACTCCAAGGGGAAGG - Intronic
910017292 1:82541928-82541950 ACACATAGACTAAAAGGAAAGGG + Intergenic
911756158 1:101559447-101559469 GTAGATAGGCTAAAATGAGAGGG - Intergenic
912199925 1:107445130-107445152 ACAGATAGACTATGATGAGAGGG + Intronic
912367399 1:109145889-109145911 AGAAATAGAATAGAATGAGATGG + Intronic
912601361 1:110936861-110936883 ACATATAGACTACAAATAAAGGG + Intergenic
916012913 1:160722959-160722981 CGAGGTAGCCTACAATGAGAGGG + Intergenic
917601344 1:176577398-176577420 AAAAATAGACTGTAATGAGAAGG + Intronic
917778674 1:178367220-178367242 GCAGCTAGACTGGAATGAGAGGG - Intronic
918416885 1:184319060-184319082 ACAGGTAGAATCCAATAAGAGGG - Intergenic
918469527 1:184857150-184857172 ACAGATAGAGTGCAAGGTGATGG + Intronic
920237928 1:204521539-204521561 ACAAAAAGGCTACAAGGAGAGGG - Intronic
920893578 1:210019347-210019369 ACTATTAGACAACAATGAGATGG - Intronic
921797298 1:219361323-219361345 ACAGATAAACTACACTATGAGGG - Intergenic
1064911490 10:20406570-20406592 ACAGATAGTCTGCAATGACAGGG + Intergenic
1067840827 10:49677979-49678001 ACATGCAGATTACAATGAGAAGG + Intergenic
1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG + Intronic
1068386345 10:56332745-56332767 ACAGATAGAATAAAATGAAAGGG - Intergenic
1069335563 10:67345691-67345713 ACAGATAGACTAAAAATAAAGGG - Intronic
1069441494 10:68432867-68432889 ACAGATAGAAGACAGGGAGAAGG - Intronic
1070386623 10:75930970-75930992 ACAGATAGACTACAAAGTATTGG + Intronic
1072897022 10:99376127-99376149 ATAGATGGACTAGACTGAGAAGG - Intronic
1074779814 10:116793845-116793867 ACAGAAAGCATAAAATGAGATGG + Intergenic
1075681096 10:124332409-124332431 ACAGATTACCTACAATTAGATGG + Intergenic
1076466187 10:130683459-130683481 ACTAGTAGAATACAATGAGAGGG + Intergenic
1078025975 11:7696073-7696095 ACAAATAGACAACCATGAGAAGG - Intronic
1078584404 11:12569527-12569549 ACAGACTGACTGCAATAAGAAGG - Intergenic
1080778281 11:35406688-35406710 ACAGATAGAATTTACTGAGATGG + Intronic
1082033833 11:47627576-47627598 AGAGATAGACTATATTGACATGG - Intronic
1085544426 11:77303766-77303788 GCAGGTAGATTACAATTAGAAGG - Intergenic
1085697826 11:78720844-78720866 GGAGATAGACTATAATTAGAAGG + Intronic
1088696315 11:112369203-112369225 ACTGATAGACTACAATTGGTTGG - Intergenic
1090842524 11:130504579-130504601 ACAGAGAGACTAAAAACAGAGGG - Intergenic
1092395879 12:8126059-8126081 GCAGGTAGACAACAAGGAGATGG + Intronic
1093131143 12:15392790-15392812 ACAGAGTGACTACAATAATAGGG - Intronic
1093634247 12:21445893-21445915 ACAGAGAGAGTAAAATGAGGGGG + Intronic
1095861473 12:46922587-46922609 AAAGATAGACTACAAAGAAAAGG - Intergenic
1096292676 12:50354377-50354399 ACAGAAAGACCACAAGGAGAAGG - Exonic
1096905003 12:54927122-54927144 ATAAATTGACTAAAATGAGAGGG - Intergenic
1099614781 12:84920453-84920475 TCAGATAGAATATCATGAGATGG - Intergenic
1099732152 12:86518812-86518834 ACAGATAAGCTACAATGAGTTGG - Intronic
1101572279 12:105964714-105964736 ACAGACAGAGTAGAAGGAGATGG - Intergenic
1106623395 13:31393516-31393538 ACAGATTGAGTTCATTGAGAAGG + Intergenic
1106636998 13:31539792-31539814 ACAGATAGATTAATAAGAGAAGG + Intergenic
1106915750 13:34512241-34512263 ACAGCTAGAAAACAATAAGATGG + Intergenic
1107982259 13:45745010-45745032 ACAGTTAGTCTCCAATAAGAAGG - Intergenic
1111215068 13:85130849-85130871 TAAGATAGACCTCAATGAGATGG - Intergenic
1112274924 13:98008103-98008125 CCAGACAGACTTCAATGATATGG + Exonic
1113353720 13:109556075-109556097 ACAGATGGACTAAAAAGTGATGG + Intergenic
1114164872 14:20210991-20211013 TCAGAGAGGCTACACTGAGAAGG + Intergenic
1114474370 14:22983255-22983277 ACAGATAAACTGCAATAAAAAGG + Intergenic
1115394491 14:32892392-32892414 ACAGGAAGACTTCCATGAGAAGG - Intergenic
1115429121 14:33295852-33295874 ACAGTCAGAATACAATGGGATGG + Intronic
1116047846 14:39766003-39766025 ACAGATAGAATACAAAGGGAAGG - Intergenic
1116450420 14:45058611-45058633 ACACATAGACTAAAATTAAAGGG - Intronic
1117786671 14:59292935-59292957 ACAAATATAATACACTGAGAAGG + Intronic
1118090004 14:62463794-62463816 ACAGATTGAGTATAATGACAAGG - Intergenic
1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG + Intergenic
1121900599 14:97690222-97690244 ACAGAGAGAGCACAATGAAAAGG - Intergenic
1122101688 14:99416619-99416641 TCAGAAAGACGACAGTGAGAGGG + Intronic
1122630733 14:103106684-103106706 TCACTTAGACTACAATGTGAAGG - Intronic
1125706465 15:41741587-41741609 ACAGATAAAAGAAAATGAGAGGG - Intronic
1126574899 15:50186735-50186757 ACAGCTATAAGACAATGAGAAGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127013827 15:54660515-54660537 AGAGACAGAGTACAATGAGGTGG - Intergenic
1127896263 15:63302002-63302024 AAAGAGAGACTTCAATGAAAAGG - Intronic
1130302437 15:82690006-82690028 ACAGGGAGACTACCATGTGAAGG + Intronic
1130873570 15:87992500-87992522 ACGCATACACTACAATGAAATGG + Intronic
1131478893 15:92765321-92765343 ACAGATAGACTTCATTCAGTTGG + Intronic
1135432064 16:22393195-22393217 ACAGATAGACTGCAGAGAAAAGG - Intronic
1135934240 16:26766113-26766135 ACAGATAGATGACATTGATAGGG + Intergenic
1136995685 16:35186914-35186936 ACAGATAGATCACGATGGGATGG + Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1137541582 16:49366021-49366043 ACAGATGGACAGGAATGAGAGGG + Intergenic
1137894815 16:52199848-52199870 ACAGATATATTAAAATGGGAGGG - Intergenic
1138507192 16:57484278-57484300 ACAGCCAGACGACACTGAGATGG - Intronic
1139004703 16:62556257-62556279 ACAGATAGACTAAAAATAAAAGG - Intergenic
1140605296 16:76529155-76529177 AAAGACAGGCTACAAAGAGAAGG - Intronic
1140694188 16:77515878-77515900 ACACATAGAACACAATGGGATGG + Intergenic
1140865492 16:79057456-79057478 ACAGAAAGACTCTAATGAGAAGG - Intronic
1152895059 17:82906147-82906169 GCAGATAAACAAAAATGAGAAGG - Intronic
1153911064 18:9707368-9707390 TCAGATAGATTACATTGAAAAGG + Intergenic
1154274977 18:12950782-12950804 AAATATAGATTACAATAAGAAGG - Intronic
1155999511 18:32369505-32369527 ACAGATAGAATATATGGAGATGG + Intronic
1156535371 18:37859159-37859181 ACACATAGACTAAAATAAAAGGG - Intergenic
1158706390 18:59796049-59796071 ACTGATAAACTTCGATGAGATGG + Intergenic
1162581788 19:11535974-11535996 ACAGACCTACTACAATCAGAGGG + Intergenic
1163108860 19:15145183-15145205 ATAGATACACAACAATGAAAAGG + Intergenic
1164805338 19:31112024-31112046 ACAGAGAGCAGACAATGAGAAGG + Intergenic
1166991512 19:46695622-46695644 GCAGATGGAATAGAATGAGATGG + Intronic
925850856 2:8080792-8080814 ACAGAAAGGCTGCTATGAGAAGG - Intergenic
926978088 2:18534903-18534925 TCAGATAGATTACAATCACAAGG - Intergenic
927483873 2:23475546-23475568 CCAGATAGTCTAGAAAGAGAGGG - Exonic
930855389 2:56010904-56010926 AAAGAAAGAATACAATGACATGG - Intergenic
931708994 2:64971411-64971433 ACAGATAGACTAAAAACTGATGG + Intergenic
936749006 2:115617923-115617945 AGAGAGAGACCACAATGACATGG - Intronic
940760646 2:157734875-157734897 ACAGAAAGACTAAAATGAAAAGG + Intergenic
940785652 2:157978578-157978600 ACAGATCAATAACAATGAGATGG - Intronic
941952437 2:171170195-171170217 ACAAAAAGACTACAAAGAAAAGG + Intronic
942575691 2:177361268-177361290 ACAGCTAAACTTCAATGAGAAGG - Intronic
943399211 2:187384084-187384106 AAAGAAATACTACAATGAGGAGG - Intronic
944866128 2:203864158-203864180 CCAGATACAATACACTGAGAAGG - Intergenic
945065643 2:205945659-205945681 GCAGATAGAATACACTGAGTGGG - Intergenic
945379280 2:209120351-209120373 ACAGAAAAACTAAAATCAGAAGG + Intergenic
945519654 2:210809301-210809323 ACAGATAGACAAAAATTAAAGGG - Intergenic
947093630 2:226541845-226541867 TCAGATTGACAAAAATGAGAAGG + Intergenic
1170472977 20:16686586-16686608 AGAGATAGACTATAATGAATTGG - Intergenic
1170735627 20:19011713-19011735 ACAGAAGGAGTAAAATGAGAAGG + Intergenic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1177533190 21:22390088-22390110 ACACATACATTGCAATGAGAAGG - Intergenic
1178743472 21:35225107-35225129 ACAGATAGACTGCATTTAAAGGG - Intronic
1182770816 22:32795030-32795052 TCACATAGAATACAATGAGATGG - Intronic
1182890579 22:33815314-33815336 ACAGCTGGACAACAATGATAAGG - Intronic
1184579071 22:45400824-45400846 TCTGATAGAATATAATGAGAAGG + Intronic
949176842 3:1073790-1073812 ACAGTTGGAATACAAAGAGAGGG - Intergenic
953286350 3:41613957-41613979 ACAGCTATACCACAATGACAAGG + Intronic
955012995 3:55037691-55037713 AAACATACACTAAAATGAGATGG - Intronic
957378830 3:79397010-79397032 ACAGATAGACTAAATATAGAAGG - Intronic
958542904 3:95501986-95502008 ACAGATAGATTACCATAACATGG + Intergenic
958653834 3:96975724-96975746 ACAGATGGATGACAAAGAGATGG - Intronic
959336567 3:105073574-105073596 ATAGATAGACTAAAATTAAAAGG + Intergenic
959356890 3:105343041-105343063 CCTGATATACTACAATGAGAAGG + Intergenic
965049923 3:163633287-163633309 GCAGATAGCCTGCAATGAGCAGG - Intergenic
965976568 3:174631296-174631318 TCACATAGACTACAGTGAGAAGG - Intronic
967133174 3:186491383-186491405 TCAGATAGATTCCAAGGAGAGGG - Intergenic
972334137 4:38091759-38091781 CCAGACAGACTAGAATGAAAAGG + Intronic
975397442 4:73893385-73893407 ACGGAAAAACTACAATAAGATGG + Intergenic
976141494 4:81997773-81997795 ACAGAGAGACTACTATAATAGGG + Intronic
978704377 4:111689097-111689119 AAAGATAGATCAAAATGAGATGG + Intergenic
980412446 4:132439652-132439674 GTAGATAGTCTAAAATGAGAGGG + Intronic
981405127 4:144358997-144359019 ACAGATAAACTTCAGCGAGATGG - Intergenic
982936091 4:161477223-161477245 GCAGATAAATTACTATGAGATGG - Intronic
983356511 4:166666903-166666925 ACAGAAAGACTACGGTAAGACGG + Intergenic
983954931 4:173686415-173686437 ACAGATTGACTGCAATGACATGG - Intergenic
984080914 4:175249024-175249046 ATAGATTGAGGACAATGAGAAGG + Intergenic
986303358 5:6496080-6496102 ACAAATAGAGTGCAATGAGGGGG + Intergenic
989271825 5:39542583-39542605 ACAGAAACAATAGAATGAGATGG - Intergenic
991032346 5:62095780-62095802 GGAGATAGATTAAAATGAGAGGG + Intergenic
991467031 5:66924313-66924335 AAAGATAGACCACAATAATAGGG - Intronic
996496592 5:124164222-124164244 CCACATAGACAACAATGTGAGGG + Intergenic
997576589 5:134982635-134982657 CCAGATAAACAAAAATGAGAGGG + Intronic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1000733720 5:164871060-164871082 ATAGAAATAGTACAATGAGAAGG + Intergenic
1000868181 5:166540780-166540802 ACAGTAATACTAAAATGAGAGGG + Intergenic
1001379625 5:171295546-171295568 ACAGAAAGACTGAAATGGGAGGG - Intronic
1002487293 5:179548217-179548239 CCTGAGAGACTACAATGAGTTGG + Intergenic
1004206985 6:13600782-13600804 ACAGCCAGACGACAAGGAGAAGG - Intronic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1004514364 6:16309468-16309490 ACACATAGGATACATTGAGAGGG + Intronic
1008033783 6:46725130-46725152 ACAGAAAGATTTCAAAGAGATGG + Intronic
1009856829 6:69275201-69275223 ACAGATGGACTACAATGAATAGG + Intronic
1010320812 6:74507296-74507318 ACACATAGACTAAAAGCAGAGGG + Intergenic
1012368597 6:98474322-98474344 ACAAAAAGACTACAACCAGATGG + Intergenic
1012905934 6:105065650-105065672 ACAGCTACACAGCAATGAGAAGG - Intronic
1014191027 6:118496810-118496832 ACAGATTGACTTCATTGAGCAGG - Intronic
1014521797 6:122453113-122453135 GCAAATAGACTACAATGAATTGG - Intronic
1016324134 6:142880346-142880368 AAAAATTGACTCCAATGAGAAGG + Intronic
1019720327 7:2566412-2566434 ACATATGCATTACAATGAGAAGG - Intronic
1020776693 7:12463120-12463142 ACATATTGGCTACAATGTGACGG - Intergenic
1021291416 7:18850026-18850048 ACAGATACAGTAAAATGAAAGGG - Intronic
1021584268 7:22190997-22191019 ACAGATGGAGGAAAATGAGAAGG - Intronic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1025553028 7:62273178-62273200 ACAGATAGAATCTAATGAGTAGG + Intergenic
1028111041 7:86941735-86941757 AAAATTAGACTACAATGGGAAGG + Intronic
1034844877 7:154435233-154435255 ACAGAGAGAGAACAAGGAGAAGG + Intronic
1035603854 8:916019-916041 GCAGAGAGTCTACAATGAGGAGG - Intergenic
1036740512 8:11357177-11357199 ACAGACACACGAAAATGAGAAGG - Intergenic
1037117153 8:15240524-15240546 ACTGATTCACTACCATGAGAAGG - Intergenic
1041212138 8:55563280-55563302 ACACTCAGACTTCAATGAGATGG + Intergenic
1043698761 8:83256450-83256472 ACAAATAAAATAAAATGAGATGG + Intergenic
1045980748 8:108184583-108184605 GCACATAAACCACAATGAGAAGG - Intergenic
1047883865 8:129226454-129226476 ACAGTTACACTACAATAAAATGG - Intergenic
1048227429 8:132601994-132602016 ACACATAGAATAGAGTGAGAAGG - Intronic
1048536841 8:135304377-135304399 ACAGATAGATTATATTTAGATGG + Intergenic
1048848898 8:138625504-138625526 ACAGCTCGACTCTAATGAGAAGG + Intronic
1048929091 8:139296739-139296761 ACAGAAAGAATACCATGTGAAGG + Intergenic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1051784553 9:20728188-20728210 ATAGTTAGCCTATAATGAGAGGG - Intronic
1052689580 9:31800461-31800483 AGAGACAGACTATAATGAGGTGG + Intergenic
1054789395 9:69241417-69241439 AGAGATACACTAAAATGACATGG - Intronic
1055947869 9:81707720-81707742 ACAGCTGGACTTCGATGAGAAGG - Intergenic
1057980450 9:99656642-99656664 ACAGATAGATTAAAAGGAAAAGG + Intergenic
1059721336 9:116963043-116963065 ACACATAGACTACCAGGTGAGGG + Intronic
1060325274 9:122608596-122608618 ACAGAGAGACTACAGAGAGGTGG - Intergenic
1061686914 9:132288409-132288431 ACATATACAACACAATGAGAAGG + Intronic
1203346895 Un_KI270442v1:41329-41351 ACAAATAGAATGCAGTGAGATGG + Intergenic
1188077967 X:25802989-25803011 ACACATAGACTAAAATTAAAGGG - Intergenic
1188187834 X:27137430-27137452 ACAGAGAGAAAACAATGAAAAGG - Intergenic
1188831231 X:34899747-34899769 ACAGATAAAAAACAATGAAAAGG - Intergenic
1193726239 X:85042423-85042445 ACAGACAGATAACAATGAGATGG + Intronic
1193858173 X:86631498-86631520 ACAGATAGACTGAAATAATATGG + Intronic
1194359442 X:92931151-92931173 AGGGATAGACTTCAATGAGAAGG + Intergenic
1194473570 X:94330270-94330292 TCAGATAAATTAAAATGAGAAGG + Intergenic
1195769880 X:108339329-108339351 AAAAATCGAATACAATGAGAGGG - Intronic
1195828638 X:109031187-109031209 ACACATAGACTAGAAACAGAGGG - Intergenic
1197555922 X:127953326-127953348 ACAGATAAACATCAATAAGATGG - Intergenic
1198230193 X:134681868-134681890 ACTGATACACAACAAGGAGAAGG - Intronic
1199135326 X:144243570-144243592 ACACATGGCCTACAAAGAGAGGG - Intergenic
1199457011 X:148040765-148040787 ACAGATAGACTGCAAATAAAGGG - Intergenic
1200296965 X:154929652-154929674 ACAGATAGACTACAATGAGAAGG - Exonic
1200667637 Y:6046981-6047003 AGGGATAGACTTCAATGAGAAGG + Intergenic
1202275130 Y:23110012-23110034 TCACATGGACTACAATGTGAAGG - Intergenic
1202290898 Y:23310677-23310699 TCACATGGACTACAATGTGAAGG + Intergenic
1202428121 Y:24743734-24743756 TCACATGGACTACAATGTGAAGG - Intergenic
1202442670 Y:24926357-24926379 TCACATGGACTACAATGTGAAGG + Intergenic