ID: 1200297280

View in Genome Browser
Species Human (GRCh38)
Location X:154933309-154933331
Sequence GACAGCTGAGGTGTCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297280_1200297284 5 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297284 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 11
4: 195
1200297280_1200297289 29 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297280_1200297288 28 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297288 X:154933360-154933382 TATAAGCTATCTGGCCAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1200297280_1200297287 19 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297280_1200297290 30 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297290 X:154933362-154933384 TAAGCTATCTGGCCAAGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297280 Original CRISPR GACAGCTGAGGTGTCTCCAA GGG (reversed) Intronic
900001978 1:19463-19485 GAAAGCTGGGATGTCTCTAAAGG + Intergenic
900021698 1:189986-190008 GAAAGCTGGGATGTCTCTAAAGG + Intergenic
902626638 1:17680312-17680334 TAGAGCTGAGATGTCGCCAAGGG - Intronic
907322516 1:53614309-53614331 GTCAGAGAAGGTGTCTCCAAGGG + Intronic
907713618 1:56907477-56907499 GAAAGGTGAGTTGTCTACAAAGG - Intronic
917895644 1:179484507-179484529 CCCAGCTGAGGTGCCTCCCAGGG + Intronic
919819661 1:201465217-201465239 GAAAGCTGAGGCTTCTCCCAGGG + Intergenic
921998113 1:221443815-221443837 ATCAGCTGAGGAGTCTCCCATGG - Intergenic
922419727 1:225451465-225451487 GAGAGCTGAGTTGACTCCATAGG + Intergenic
1064388898 10:14924035-14924057 GACAGCTGGGGTGTGCCTAAGGG + Intronic
1067451868 10:46386668-46386690 GCCAGCTGGGGTGTCTCAGATGG - Intronic
1067585370 10:47473087-47473109 GCCAGCTGGGGTGTCTCAGATGG + Intronic
1069080478 10:64083366-64083388 CACAGCTGAGGACTCTCCATAGG - Intergenic
1073831426 10:107387998-107388020 CACAGGTGAGGTGTTTACAAAGG - Intergenic
1073986137 10:109211417-109211439 GAGAGCTGAGGTGGCTTTAACGG + Intergenic
1075082577 10:119393693-119393715 GGCAGCAGTGGCGTCTCCAAAGG - Intronic
1076450934 10:130556561-130556583 GCCAGCTGAGCTGCCACCAATGG - Intergenic
1077089217 11:770848-770870 GACAGCCCAGGTGTCTCCAGAGG - Exonic
1077456870 11:2686563-2686585 GACAGCTGTGGTGACTAGAATGG + Intronic
1077497909 11:2895448-2895470 GAGAGCTGAGAGGCCTCCAAGGG + Intronic
1077551515 11:3202561-3202583 GACAGCTCAGCTATCTCCAAAGG + Intergenic
1079332661 11:19546483-19546505 GAAAGCTGAGGATTCTGCAAAGG - Intronic
1080787883 11:35492720-35492742 GACAGGAGAGTTGTTTCCAATGG - Intronic
1084643416 11:70439704-70439726 GACAACGGAGCTGTCTCAAATGG - Intergenic
1084887094 11:72217922-72217944 GACAGCTGAGGAGGCTGGAAAGG + Intronic
1085256350 11:75175823-75175845 GACAGCTCAGATTTCTCCCATGG + Intronic
1087897781 11:103606340-103606362 GTCAGCTAGGGTGGCTCCAAGGG + Intergenic
1090064548 11:123491744-123491766 GACAGCTGGGGTAGCTGCAAGGG + Intergenic
1093465204 12:19440830-19440852 GATAGCTGGGGTCTCTCCCATGG - Intronic
1095128230 12:38507655-38507677 GACATCTGAGATGTCTGAAAAGG - Intergenic
1095777226 12:46023635-46023657 CACAGCTGAGGCTTCTCCCATGG - Intergenic
1096249398 12:50018895-50018917 GTCAGCTGAGGTGGCGCCAGTGG - Intronic
1096510715 12:52126505-52126527 AACAGCTGAGGTGACTGGAAAGG - Intergenic
1102147782 12:110667739-110667761 GCCAGGTAAGGTGTTTCCAAAGG - Intronic
1102236219 12:111296219-111296241 GGCAGATGAGGTCTCTCCATGGG - Intronic
1102420625 12:112800327-112800349 GACAACTGTGGTGGCCCCAAGGG + Intronic
1103038962 12:117678931-117678953 GTCTGCTGAGGGGTCTGCAAGGG + Intronic
1106042964 13:26111392-26111414 CACAGCTGAGGGGGCTCCTAGGG - Intergenic
1113488788 13:110676293-110676315 GACACCTCAGGTGCGTCCAAGGG + Intronic
1114442815 14:22764457-22764479 GTCACCTGAGGTGGCTCCAGTGG + Intergenic
1114724417 14:24920438-24920460 GAGAGCTGAGGTGACTCCTCAGG + Intronic
1114726670 14:24945053-24945075 GAAAGCTTTTGTGTCTCCAAGGG + Intronic
1116324266 14:43511653-43511675 GAAAGCTGAGGTGACCCCAAAGG - Intergenic
1119543341 14:75454954-75454976 GACGGCTGCAGTGGCTCCAAAGG - Intronic
1128238406 15:66082933-66082955 GACAGGTGAGGGGTCCCAAAAGG - Intronic
1132455358 16:19152-19174 GAAAGCTGGGATGTCTCTAAAGG + Exonic
1132468629 16:89552-89574 GACAGGAGAGGTGTCTCCACGGG + Intronic
1133075134 16:3274282-3274304 TTCAGCTGAGGTGGCTCAAATGG + Intronic
1134072771 16:11271168-11271190 GACAGAAGAGGTGTCACCCAGGG + Intronic
1134692595 16:16200719-16200741 GACACCTGAGCTGTCACCTAGGG - Intronic
1135715030 16:24756505-24756527 CACACCTTAGGTGTCTCCATGGG + Intronic
1141508318 16:84495642-84495664 GACTGCTGAGGAGGCTGCAAAGG + Intronic
1141988576 16:87595979-87596001 GACACCTAAAGTGTCTCCAGGGG + Intergenic
1145264793 17:21374553-21374575 GACAGCTGAGTGGTCTCTGAGGG + Intergenic
1147306275 17:39566621-39566643 GACAGATGGGGTGTCTGCGATGG + Intergenic
1149045675 17:52242434-52242456 GGCTGCTGAGTTCTCTCCAAGGG + Intergenic
1152253648 17:79225040-79225062 GACTCCTGGGGTGTCTCTAATGG - Intronic
1153754099 18:8262587-8262609 CACATCTGAGCTGTGTCCAAAGG - Intronic
1158941082 18:62406296-62406318 GACAGCTCAGGTGTTTTCCATGG + Intergenic
1160449532 18:78952907-78952929 GCAAGCAGAGGTGTCTCCACTGG - Intergenic
1160625011 18:80197982-80198004 GACAGCTGTCATGTGTCCAAGGG + Intronic
1160633730 19:61071-61093 GAAAGCTGGGATGTCTCTAAAGG + Intergenic
1161808000 19:6456218-6456240 GACAGCAGAGATGTCCCAAATGG + Intronic
1162021891 19:7871868-7871890 GACAGAGGAGGTGTGGCCAAGGG + Exonic
1164927348 19:32140605-32140627 GGCAGCTGCTGTGTCTCCACTGG + Intergenic
1165116933 19:33534127-33534149 GGCAGCTGTGGTGGCTGCAAGGG + Intergenic
1168360816 19:55738389-55738411 GTGAACTGAGGTGTCTCCAGAGG + Exonic
928469843 2:31563315-31563337 GGAAGCAGAAGTGTCTCCAATGG - Intronic
931537911 2:63299186-63299208 GACAGCTGGGCTGTCTTTAAGGG - Intronic
931786934 2:65628322-65628344 GTCAGCTGAGATGGCTCCACTGG - Intergenic
932706769 2:74032137-74032159 GACAGCTCAGGTGTGTCAAAGGG - Intronic
932792130 2:74662786-74662808 GACCGCTGAGCTGGCTCAAAAGG - Exonic
933758947 2:85661457-85661479 GACAGCTGAGTTCTCATCAAAGG + Exonic
934063553 2:88319243-88319265 TACTGCTGAAGAGTCTCCAACGG - Intergenic
935130699 2:100258838-100258860 GCCATCTGAGGGGTGTCCAAAGG + Intergenic
935733863 2:106090269-106090291 GACAGGTTTGGTTTCTCCAAAGG + Intergenic
936405659 2:112200318-112200340 AACATCTGAGGTGTCCCCCATGG - Intergenic
936567744 2:113593942-113593964 GAAAGCTGGGATGTCTCTAAAGG - Intergenic
937360767 2:121228337-121228359 GACAGCTGTAGTGTCACCGAAGG - Intronic
938173833 2:129106140-129106162 GATAGCTGATGTGTTTCCCAGGG - Intergenic
938258770 2:129880631-129880653 GACAGCTGAGATGAGACCAAAGG + Intergenic
938377628 2:130819196-130819218 GCCAGCTGTGCTGTCTCCACAGG - Intergenic
942189153 2:173454108-173454130 GACAGCTCAGTAGTCCCCAAAGG - Intergenic
943796597 2:192004200-192004222 GGCAGATGTGGGGTCTCCAAAGG + Intronic
946342055 2:219076421-219076443 GACAGCTGAGGTCTCTGCAGAGG + Exonic
948717759 2:239876238-239876260 CACAGCAGAGGTGTCCCCAGGGG - Intergenic
948754290 2:240150177-240150199 GTCCGCTGAGCTCTCTCCAAAGG - Intergenic
1174796601 20:53527683-53527705 GACAGCAGATGTGTCTCCCATGG - Intergenic
1175379759 20:58554720-58554742 GGCAGCTGAGCTGACTCCACAGG + Intergenic
1175490466 20:59377189-59377211 GACAGCTGAGGTGTCTGACATGG - Intergenic
1178980067 21:37256293-37256315 GGCTGCTGAGGTGTCTTCACAGG - Intronic
1180708997 22:17826987-17827009 GACAGCAGAGGTGACTCCGAGGG + Intronic
1183710899 22:39502591-39502613 GGCAGCCGAGGGGTCTCCCAGGG - Intronic
1184440519 22:44509977-44509999 GTCAGCTGAGGAGTGGCCAATGG + Intergenic
950912588 3:16610134-16610156 GCCAGCTGAGGTTTCTTCACTGG + Intronic
950940419 3:16885187-16885209 GACAGCGGCGGGGTTTCCAACGG + Intronic
953734458 3:45479910-45479932 GGCAGATGCGGTCTCTCCAAAGG + Intronic
957698838 3:83682643-83682665 GATATCTGAAGTCTCTCCAATGG + Intergenic
959107034 3:102076447-102076469 GACTGCTGAGGTGGCCCTAAGGG - Intergenic
961378718 3:126483370-126483392 CTCAGCTGGGATGTCTCCAATGG - Exonic
964331265 3:155605880-155605902 GATACATGAGGTGTCTCCAAAGG - Intronic
965289047 3:166853046-166853068 AAAAGCTGTAGTGTCTCCAAAGG - Intergenic
968061014 3:195726189-195726211 GAGGGCTGAGGTTTCTTCAAGGG - Exonic
968581363 4:1396907-1396929 ACCAGCAGAGCTGTCTCCAAAGG + Intergenic
971485256 4:27153374-27153396 GGCAGCTGTGGTGTCTTCTAGGG + Intergenic
972870712 4:43294039-43294061 GACAGCTGAGGTGTGTCTTCTGG + Intergenic
973091776 4:46146537-46146559 CACAGCTGAGGCTTCTCCCATGG - Intergenic
981062631 4:140441919-140441941 GAAAGCTGAGATGATTCCAAGGG - Intergenic
982330273 4:154174316-154174338 GACAGCTGACTTGTCTACAGAGG - Intergenic
985819527 5:2150138-2150160 GACAGGTGATGTTTCTGCAACGG + Intergenic
987105290 5:14632840-14632862 CACTGCTGGGATGTCTCCAAGGG + Intergenic
988795805 5:34652758-34652780 GTCAGCAGAGATTTCTCCAAGGG - Intergenic
989246764 5:39263899-39263921 CTCAGCTCAGGTGTCTCCAGTGG + Intronic
992321202 5:75614691-75614713 GATAGTTGAGGTGTATCCAATGG - Intronic
992792648 5:80227336-80227358 GAAAACTGAGGTCTCTCCTAAGG + Intronic
997610809 5:135214215-135214237 GACAGGTGAGGACCCTCCAAAGG - Intronic
999468165 5:151826606-151826628 GATTGCTGAGGTATCTTCAAAGG + Intronic
999546130 5:152630655-152630677 GTCAGCTGAGATGTTTCCAAAGG - Intergenic
1003162795 6:3650683-3650705 TACAGCTGAGGTGGGTCCAGGGG - Intergenic
1003331074 6:5129211-5129233 GACAACCCAGGTTTCTCCAAAGG + Intronic
1003409948 6:5853218-5853240 GGCAGCGTTGGTGTCTCCAAAGG - Intergenic
1003777170 6:9380661-9380683 GACAGCAGAGCTGTCTCACATGG - Intergenic
1006005332 6:30997383-30997405 GATAGCTGAGCTGTATTCAAAGG + Intergenic
1007548177 6:42709708-42709730 GGGAGCTGGGGTGTCACCAATGG - Intronic
1008640930 6:53462180-53462202 CACAGCTCAGGGGTCCCCAATGG - Intergenic
1010260565 6:73811138-73811160 GACAGCAGAGGTGTGGGCAAGGG + Exonic
1013040331 6:106426642-106426664 GAGAGCTCAGGTGTCCCCAGTGG + Intergenic
1014957484 6:127638744-127638766 GACAGCTCAGGTGTCCTCACAGG + Intergenic
1016597966 6:145822683-145822705 GAAATCTGAGGTCTCTCCAGTGG + Intergenic
1019300222 7:299326-299348 GCCAGCTGTGGTGCCTCCATTGG - Intergenic
1024199224 7:47089512-47089534 GACTGCTCAGGTGTCTCCCAGGG + Intergenic
1025094188 7:56084896-56084918 GACATTTGAGCTGTCCCCAAGGG + Intronic
1026389963 7:69890780-69890802 CACAACTGAGTTGTCTCCAGTGG + Intronic
1027560475 7:79722238-79722260 GAAAGCAGTGCTGTCTCCAAGGG - Intergenic
1029161825 7:98557994-98558016 GACAGATCAGGGCTCTCCAAGGG + Intergenic
1031534805 7:122920196-122920218 GTCAGCAGAGCTGCCTCCAATGG - Intergenic
1032853749 7:135817044-135817066 GCCAGCTGAGCTGTCGGCAAGGG - Intergenic
1033563410 7:142555733-142555755 GACAGCCGGGGTGTCACTAAGGG - Intergenic
1035011964 7:155727237-155727259 GCCAGCTGAGGTATCCCCCAGGG + Intronic
1035316872 7:158002042-158002064 GTCACCCGAGGTGACTCCAAGGG - Intronic
1036478685 8:9118371-9118393 GACTGCTGAAGTCTCACCAATGG + Intergenic
1036746938 8:11416587-11416609 GACAGCTAGGCGGTCTCCAAAGG - Intronic
1041647263 8:60265558-60265580 TACTGTTGAGGTTTCTCCAACGG + Intronic
1042971838 8:74417075-74417097 CACAGCTGGGGTTTCTCCCATGG + Intronic
1043508985 8:80931356-80931378 AACAGCAGAGGTGACTCCACTGG - Intergenic
1046049321 8:109002807-109002829 GTCAGCTGAAGTGGCTCAAATGG - Intergenic
1046784522 8:118251873-118251895 GACAGCTGAGGAGTCTTCCTCGG + Intronic
1047538676 8:125743240-125743262 GACAGCTGGGGGGACTCCCAGGG - Intergenic
1049884786 9:19576-19598 GAAAGCTGGGATGTCTCTAAAGG + Intergenic
1055731960 9:79287568-79287590 GACAGCTAAGGTGGCTGGAAGGG + Intergenic
1057789987 9:98118481-98118503 GACAGCTGAGGCTGCTCCCAGGG + Intronic
1058781016 9:108335645-108335667 GAGAGGTGGGGTGTCACCAAAGG - Intergenic
1060149126 9:121276390-121276412 ACCAGCTGAGGTGGCCCCAAGGG + Intronic
1060794726 9:126506005-126506027 GAAAGTTGAAGTATCTCCAAAGG + Exonic
1185461561 X:335063-335085 GAAAGCAGAGGTGTCCCCACAGG - Intronic
1186609109 X:11121390-11121412 GACAGCTCATCTGTCTACAAAGG - Intronic
1187162628 X:16778986-16779008 GACATCTGAGCTGTGTCTAAAGG - Intergenic
1189579767 X:42393905-42393927 GTCAGCTGGGGTGACTCAAATGG + Intergenic
1194913382 X:99674692-99674714 GACACCTGTGGTCTATCCAAAGG + Intergenic
1195349482 X:103983239-103983261 GATGCCTGAGGTGTCTTCAAAGG - Intergenic
1195357961 X:104055600-104055622 GATGCCTGAGGTGTCTTCAAAGG + Intergenic
1195383908 X:104295871-104295893 GACAGCAGAAGTGGCTCCTAGGG + Intergenic
1199968755 X:152843001-152843023 GACAGCTTAGCTGTCTCTATGGG - Intronic
1200297280 X:154933309-154933331 GACAGCTGAGGTGTCTCCAAGGG - Intronic
1200401022 X:156020576-156020598 GAAAGCTGGGATGTCTCTAAAGG - Intergenic
1202282399 Y:23203389-23203411 GACAGCTGAGGTTTCTTCACTGG + Intergenic
1202283492 Y:23215130-23215152 GACAGCTGAGGTTTCTTCACTGG - Intergenic
1202434070 Y:24817774-24817796 GACAGCTGAGGTTTCTTCACTGG + Intergenic
1202435169 Y:24829516-24829538 GACAGCTGAGGTTTCTTCACTGG - Intergenic