ID: 1200297282

View in Genome Browser
Species Human (GRCh38)
Location X:154933321-154933343
Sequence GAGGAGGAGATTGACAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297282_1200297287 7 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297282_1200297288 16 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297288 X:154933360-154933382 TATAAGCTATCTGGCCAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1200297282_1200297290 18 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297290 X:154933362-154933384 TAAGCTATCTGGCCAAGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1200297282_1200297284 -7 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297284 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 11
4: 195
1200297282_1200297289 17 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297282 Original CRISPR GAGGAGGAGATTGACAGCTG AGG (reversed) Intronic
901653727 1:10757381-10757403 GAGGAGGAGGTGGACAGGCGGGG - Intronic
901769122 1:11521572-11521594 GAGGAGGAGTTAGCCAGTTGAGG + Intronic
901848333 1:11998940-11998962 GAGCAGGAGCTTGACAGCCAAGG - Intronic
902067797 1:13702868-13702890 GAGGAGGAGGTTGATGGTTGGGG + Intronic
902544047 1:17175263-17175285 GAGGAGAATATGGACAGGTGGGG - Intergenic
902748893 1:18492858-18492880 GGGGTGGAGAGTGACAGCGGGGG + Intergenic
903321720 1:22547374-22547396 GAGGAAGAGAGAGACAGATGGGG - Intergenic
904136673 1:28317901-28317923 GAGGATAAGATTGTCAGTTGTGG - Intergenic
904497233 1:30893778-30893800 CCTGAGGAAATTGACAGCTGGGG - Intronic
904810337 1:33159641-33159663 GAGGAGGGGATGGTCAGCCGGGG + Intronic
904821228 1:33245957-33245979 GAGGGGGAGAGAGACAGCTGTGG + Intergenic
905529256 1:38663715-38663737 GAGGAGGAGAGTCATAGGTGAGG - Intergenic
905865007 1:41371926-41371948 GAGGAGGAGGAGGCCAGCTGAGG - Intronic
906630201 1:47360910-47360932 GAGGAGGAGATGGGCAGGTTGGG + Intronic
907819253 1:57951173-57951195 AAGGAGCAGATTGAAAACTGTGG - Intronic
908723393 1:67149345-67149367 GAGGCGGAGAGTGACACCTAGGG + Intronic
909554918 1:76942791-76942813 GAGGTGGAGAATGACAGGAGAGG - Intronic
912950190 1:114115358-114115380 GAGGAGGAGATTAACAGTTATGG + Intronic
913194812 1:116446939-116446961 GGGGAGGCCATTGACAGCTAAGG + Intergenic
913195145 1:116450076-116450098 GGGGAGGCCATTGACAGCTAAGG + Intergenic
914902377 1:151717677-151717699 AAGGGGAAGCTTGACAGCTGTGG - Intronic
915974372 1:160375306-160375328 GAAGAGGGCATGGACAGCTGGGG - Intergenic
915979705 1:160412270-160412292 GATGAGGAGATGGACAGCCTGGG + Intronic
916715801 1:167445803-167445825 GAGAAGGAGGTTGACTGCAGGGG - Intronic
918009404 1:180572585-180572607 GAGGAGGAGATTTGCAGGGGTGG - Intergenic
918174271 1:182029673-182029695 GAGGCGGAGCTTGTCCGCTGGGG + Intergenic
919829523 1:201530811-201530833 GATGAGGAGATTCTGAGCTGGGG + Intergenic
920225988 1:204439606-204439628 GAGAAGGAGAGAGACAGTTGGGG - Intronic
920511069 1:206552405-206552427 GAGGAGGATTTTGACATCAGAGG + Intronic
922558166 1:226548823-226548845 GAGCAGGAGACTGTCGGCTGCGG - Exonic
923010233 1:230082819-230082841 GAGCAGGATAAGGACAGCTGTGG + Intronic
923268722 1:232335801-232335823 GAGAGGGAGCTTGTCAGCTGTGG - Intergenic
923438700 1:233994766-233994788 GATGAGGAAATTGAGGGCTGGGG - Intronic
924067714 1:240242687-240242709 CAGAAGGAGACTGACAGCTGTGG - Intronic
1064449392 10:15427549-15427571 CATGAGGAAATTGACATCTGTGG + Intergenic
1067469326 10:46524644-46524666 GAGGAGGAGTTTCAGTGCTGGGG + Intergenic
1069654120 10:70075278-70075300 GATGAGGAAATTGACATCTTTGG + Intronic
1070997303 10:80797008-80797030 GACCAGGAGAAGGACAGCTGGGG - Intergenic
1071767325 10:88682275-88682297 GAGAAGGAGATGAAGAGCTGAGG - Intergenic
1073466607 10:103697967-103697989 GATGAGGAGATTGAGGTCTGAGG + Intronic
1074052852 10:109895609-109895631 GAGAAGGAGAGTGACAGCCCTGG - Intronic
1075513768 10:123093501-123093523 GAGGAGGAGGAGGACAGCTGGGG - Intergenic
1076738337 10:132468528-132468550 GGGGAGGAGATGGAAAGCAGGGG + Intergenic
1077265521 11:1647167-1647189 CACAAGAAGATTGACAGCTGTGG + Intergenic
1077635273 11:3837911-3837933 GAGGAGGAGCTTCTCAGCTAGGG - Intronic
1078673608 11:13388514-13388536 GTGGTGGAAATTGGCAGCTGGGG - Exonic
1079117220 11:17647503-17647525 GAAGAGGACATTGGGAGCTGGGG + Intergenic
1079164753 11:18029308-18029330 GAAGAGGAGATTAAGACCTGGGG - Exonic
1080801142 11:35611422-35611444 GAAGTGGAGATTTACAGGTGGGG - Intergenic
1083299026 11:61730630-61730652 GAGGAGGTTATTGGCTGCTGGGG - Intronic
1085083828 11:73653756-73653778 GAGGAACAGAAGGACAGCTGGGG + Intronic
1085807766 11:79651980-79652002 GAGGAAGAGATTGAGAGGTTTGG + Intergenic
1088975875 11:114816094-114816116 GAGCAGGAGATGGCCAGATGTGG - Intergenic
1089790535 11:120940015-120940037 GAGGAGGAAATTGGCAGATTGGG - Intronic
1090222134 11:125036560-125036582 GAGGAGGAAATCGAAAGATGAGG - Intronic
1090464193 11:126919215-126919237 GTGGATGAGATTGAGCGCTGTGG + Intronic
1090717055 11:129440117-129440139 GAGGAGGAGGGTGAGAGCTGTGG - Intronic
1090764338 11:129863910-129863932 GAGGAGGGGACGGACAGCAGAGG - Intronic
1091145762 11:133278592-133278614 GAGGAGGAGATTGAGATGAGAGG + Intronic
1091211481 11:133864744-133864766 GAGGAGGAGACTGGCTACTGAGG - Intergenic
1091963724 12:4720730-4720752 CAGAAGGAGATTGACAGCAATGG - Exonic
1091978506 12:4846630-4846652 TAGGAGGAGATTGACATTTCTGG - Intronic
1092051809 12:5476269-5476291 TAGGTGGAGTTAGACAGCTGAGG + Intronic
1092964306 12:13626841-13626863 GAGGAGGAGATAAAGAGCTATGG - Intronic
1094553524 12:31475090-31475112 GAGGAGGAGATTGAGGCTTGGGG - Intronic
1095978262 12:47954559-47954581 TAGAAGGAGATTGAGAACTGTGG - Intergenic
1096603834 12:52750419-52750441 GTGGTGGAAATTGGCAGCTGGGG + Intergenic
1097791685 12:63821952-63821974 GAGGAGGAGAGCGAATGCTGGGG - Intergenic
1100197970 12:92269021-92269043 GATGAGGAAACTGAAAGCTGGGG + Intergenic
1101826852 12:108227101-108227123 GCGGAGGAGTTTGAGAGCTGCGG + Exonic
1101859044 12:108467858-108467880 GAGGAGGAGAGTCACTGCTTAGG + Intergenic
1102029906 12:109734303-109734325 GAGGTGGAGATTGACGGCAGGGG + Intronic
1102471791 12:113163515-113163537 GAGGAGGAGAGTGCCGGCCGAGG + Intronic
1102769032 12:115457360-115457382 GAGGAGGAGATTTATTCCTGGGG - Intergenic
1103047400 12:117748859-117748881 GATGAGGAGATGGAGAGGTGAGG + Intronic
1103223046 12:119262236-119262258 GGGGAGGGGCTTGAAAGCTGAGG + Intergenic
1103673271 12:122635744-122635766 GAAGATGAACTTGACAGCTGCGG + Intergenic
1103949007 12:124541497-124541519 GAGGAGGAGATGGAGGGGTGGGG + Intronic
1106900295 13:34348593-34348615 GAGGAGAAGAAAGACAGATGAGG + Intergenic
1107242595 13:38254733-38254755 GTGGAGGAGATTTGCATCTGTGG + Intergenic
1109961946 13:69643344-69643366 GAGGAGGAGAGAGATAGGTGAGG - Intergenic
1110112060 13:71760108-71760130 GAGGAGTAAATTGGCACCTGGGG - Intronic
1110623063 13:77621117-77621139 GAAGGGGAGATTGGCAGCAGAGG - Intronic
1111123577 13:83883312-83883334 GAGGAGGAGATAGAAATCTCTGG + Intergenic
1111749354 13:92307969-92307991 CAGATGGAGAGTGACAGCTGAGG + Intronic
1113647965 13:112012248-112012270 GAGGAGGAGGGTGACGGGTGGGG - Intergenic
1116307743 14:43280359-43280381 GGGGAGGATATTGACACCAGGGG + Intergenic
1117977962 14:61317256-61317278 GGGAAGGAGAGTGAGAGCTGAGG - Intronic
1119108148 14:71943824-71943846 GAGTTGCAGAGTGACAGCTGTGG + Intronic
1120734713 14:88040156-88040178 GAGGAGGAACTGGACAGTTGTGG - Intergenic
1121074975 14:91060409-91060431 GAGGAGGAGGGTGGCAGCAGCGG - Exonic
1121337225 14:93084838-93084860 GGGCAGGAGTTTGCCAGCTGAGG - Intronic
1124620608 15:31271930-31271952 GAGGCAGAGATGGGCAGCTGAGG - Intergenic
1125147130 15:36484677-36484699 GATGAGAAGGCTGACAGCTGTGG + Intergenic
1125797263 15:42411893-42411915 GAGGAGGAGCATGACTGATGAGG - Exonic
1126685744 15:51247407-51247429 CAGGAGGAGGTTGACAGATTGGG - Intronic
1127843353 15:62848714-62848736 GAGGAGGAAGAAGACAGCTGTGG - Intergenic
1129056616 15:72824703-72824725 GAGGAGGAGAATGCCCTCTGAGG - Intergenic
1129154715 15:73710574-73710596 GGGCAGGAGATTGACACTTGGGG + Intronic
1130056779 15:80533106-80533128 GGGGAGGGGATTGACAGCCAGGG + Intronic
1130149310 15:81299259-81299281 GAGGAGGAGATTAGCAGAAGTGG - Intronic
1130376739 15:83335933-83335955 GAGGAAGAGATTCAAAGCTTAGG - Intergenic
1132216003 15:100062132-100062154 GAGGAGGAGAGTGCCAGGCGAGG + Intronic
1133149845 16:3819398-3819420 GAGGAGGTGAGAGACAGCTTTGG + Intronic
1133905836 16:10021581-10021603 CAGGAGGGGATTGACAGGAGCGG + Intronic
1134316884 16:13127068-13127090 GAGAGGGAGAGAGACAGCTGAGG + Intronic
1137067520 16:35863781-35863803 GAGGTGGAGATGGAGAGATGGGG + Intergenic
1139459845 16:67112903-67112925 GGGGAGGAGATTGACAGAGGTGG - Intronic
1140222734 16:73055918-73055940 GAGGAGGCGATTCAGATCTGTGG - Intronic
1141325290 16:83051363-83051385 GAGGATCAGATTAAGAGCTGTGG + Intronic
1142007511 16:87696540-87696562 GAAGAGGTGAGCGACAGCTGCGG - Intronic
1142852152 17:2709501-2709523 GAGGAGGAGGCTGGCAGCTGGGG - Intronic
1143875457 17:9987436-9987458 GAGGAGAAGATTAACATCTTTGG - Intronic
1144006532 17:11105388-11105410 GAGGAGGTGGTTGCCATCTGTGG + Intergenic
1144855413 17:18264696-18264718 GAGGAGGAGATTGACGACATTGG + Exonic
1145320724 17:21765801-21765823 GTGGGGGAGGTTGACAGTTGTGG - Intergenic
1146724616 17:35147439-35147461 TGGGAGCAGAGTGACAGCTGAGG - Intergenic
1147882046 17:43660491-43660513 GAGGGGGAGATGGAGGGCTGAGG - Intronic
1147910813 17:43854905-43854927 GAGGAGGAAATTGACACCCTGGG + Intronic
1150913533 17:69413217-69413239 GCGGGGGAGATTTACAGGTGAGG - Intergenic
1152036806 17:77878557-77878579 GGGGAGAAGATTGACTGCAGAGG - Intergenic
1152622762 17:81373489-81373511 GAGGAGGAGGCATACAGCTGGGG - Intergenic
1153329810 18:3862398-3862420 GAGGAAGAGAATCACAGATGAGG + Intronic
1153586059 18:6621884-6621906 GAGGAGGAGATGGAAGGATGGGG - Intergenic
1155435839 18:25811948-25811970 AAGCAGGTGATTGACAGGTGAGG - Intergenic
1156364597 18:36414356-36414378 TAGGAAGAGATGGACATCTGAGG - Intronic
1156557740 18:38086571-38086593 AAGGTGGAGATTGACTCCTGGGG - Intergenic
1157705013 18:49799204-49799226 GAGGGGGAGAGGGAGAGCTGTGG - Intronic
1157879142 18:51303519-51303541 GAGGAGGAGACTGGTAGATGAGG + Intergenic
1158417148 18:57258471-57258493 GAGGAGGAAGGTGACAGCAGAGG + Intergenic
1160832886 19:1111749-1111771 GAGGAGGTGGCTGAGAGCTGGGG - Intronic
1161238794 19:3210616-3210638 GAGGAGAAGATTGCAAGCAGAGG + Intergenic
1162111972 19:8404330-8404352 GAAGAAGAGATCGAGAGCTGGGG - Exonic
1163713411 19:18860398-18860420 CAAGAGGAGATTGCCAGCTCGGG + Exonic
1164763168 19:30743398-30743420 GAGGAGGAGATTGGAAGGAGGGG + Intergenic
1166380864 19:42354530-42354552 GAGGATGAGAACGACACCTGGGG - Intronic
1166678515 19:44753903-44753925 GAGGAGCAGCTTGGCAGCTTGGG + Intronic
1167122536 19:47527204-47527226 CAGGAGGAGATTCAGGGCTGAGG + Intronic
1168153502 19:54461141-54461163 GAGGAGGGGATGGGCAGCGGAGG + Exonic
925986329 2:9218151-9218173 CAGCAGGAGACTGACAGGTGGGG - Intronic
926139373 2:10359278-10359300 GAGGGGGAGGTGGGCAGCTGGGG + Intronic
927464808 2:23329026-23329048 GAGGAGGAGGATGAGAGCAGAGG - Intergenic
927553120 2:24016121-24016143 GGGGAGGGGATAGAGAGCTGAGG - Intronic
927569392 2:24144936-24144958 GTGCAGGAGGTTGCCAGCTGTGG - Intronic
927879260 2:26679309-26679331 GGGGAAGAGAGTGAGAGCTGGGG + Intergenic
928206745 2:29289978-29290000 TAGATGGAGATTGAGAGCTGGGG + Intronic
928318445 2:30264178-30264200 GATGAGGACATGGACATCTGTGG - Intronic
930245497 2:48979543-48979565 GGGGAGGAGAAAGTCAGCTGAGG - Intronic
930928662 2:56852835-56852857 GTGGAGCAGTTTGAAAGCTGCGG + Intergenic
932623005 2:73277162-73277184 GAGGAGGAGAGGGACTTCTGGGG + Intronic
934650831 2:96090449-96090471 CAGGAGGAGAGTGGAAGCTGGGG + Intergenic
935157542 2:100496637-100496659 GAGGAGGAGATTCTCAGCAAGGG + Intergenic
936109247 2:109651446-109651468 CAAGAGGAGAATGAAAGCTGGGG + Intergenic
936537136 2:113321190-113321212 GAGGAGGAGATGAAATGCTGTGG - Intergenic
936951216 2:117979371-117979393 GGGGAGGAGCTTTAGAGCTGAGG - Intronic
937285502 2:120748416-120748438 GAGGAGGACTTTGCCAGCAGAGG + Intronic
938662690 2:133503927-133503949 GAGGAGGAGAGTGACAGCTAGGG - Intronic
941195677 2:162448780-162448802 GAGCTGGAGATTGAAAGATGGGG + Intronic
941670162 2:168284232-168284254 GAGAAGGAGCTTGCCAGCTGTGG - Intergenic
943487656 2:188507097-188507119 TAGGCGTAGATTGACAGATGGGG + Intronic
943572508 2:189590445-189590467 GAGCAGGAGATAGAGAGCTAAGG + Intergenic
943977057 2:194496199-194496221 GAGGAGGAGATTGGGGGTTGGGG - Intergenic
944136388 2:196404722-196404744 AAGGAGGAAATTGATAACTGGGG - Intronic
946104207 2:217355094-217355116 GAAGACCAGTTTGACAGCTGTGG + Intronic
946156751 2:217812016-217812038 GAGGATGAGATGGGCATCTGGGG - Intronic
946432334 2:219632355-219632377 GAGGAGGAGACGGAGCGCTGGGG + Exonic
946659395 2:221983554-221983576 TGGGAGGTGATTGACAGCAGTGG - Intergenic
947135032 2:226968840-226968862 GATGAGGAAATTGAGAGCTGAGG - Intronic
947188304 2:227473272-227473294 GAGGAGCAGATTTGAAGCTGTGG + Intronic
947495287 2:230631655-230631677 GTGGAGGATATTGACAGTGGGGG + Intergenic
947990208 2:234481261-234481283 GTGGGAGAGATTGACAGCAGTGG - Intergenic
948475508 2:238216413-238216435 GACCAGGACATTCACAGCTGTGG - Intergenic
1168976839 20:1973079-1973101 GAGGAGGTGACTGAGACCTGCGG - Intergenic
1169254150 20:4084463-4084485 GAGGCTGAGATTTCCAGCTGAGG + Intergenic
1169564339 20:6837122-6837144 GAGGCGAACATTTACAGCTGCGG - Intergenic
1169927087 20:10794767-10794789 GAGAAGGAGATTGAGAGGAGAGG - Intergenic
1171201945 20:23248845-23248867 GAGGAGGTTATTCACAGCAGTGG - Intergenic
1171249218 20:23636070-23636092 GAGGAGCAGACTGACACCAGAGG - Intronic
1171467519 20:25340840-25340862 GAGCAGGAGATTGACTGCAAGGG + Intronic
1172329587 20:34065929-34065951 GAGGAAGAGATTTAGTGCTGGGG + Intronic
1172661948 20:36574148-36574170 GCGGCCGAGAGTGACAGCTGGGG + Intronic
1172927584 20:38552878-38552900 GGTGTGGAGATTGACAGGTGTGG + Intronic
1173593262 20:44241717-44241739 GAGGGGGACATAGCCAGCTGGGG - Intergenic
1174184956 20:48699845-48699867 GAGGAATAGATGGAAAGCTGGGG - Intronic
1174272851 20:49381917-49381939 GGGGAAGAGATTGGCAGGTGGGG + Intronic
1174401965 20:50280763-50280785 CACGAGGGGATTGACATCTGGGG + Intergenic
1174917089 20:54664855-54664877 GAGGAGGAAATTGAGAGAGGGGG + Intergenic
1175487378 20:59355698-59355720 GAGGAGGAGAGGGACAGAGGAGG - Intergenic
1176177872 20:63737242-63737264 GAGGAGGGGCAAGACAGCTGTGG - Intronic
1178156048 21:29855429-29855451 GAGGAAGAGATTTCCAGCAGAGG + Intronic
1178578650 21:33817374-33817396 GAGAAGGACTTTGACAGCTAGGG - Intronic
1178813532 21:35906180-35906202 GAGGAGGAGCTGGACAGCTTTGG - Intronic
1178924261 21:36761869-36761891 GCGGAGGAGCTTGACAGCTCTGG - Intronic
1179008502 21:37534839-37534861 GAGTAGGACATGGACAGCTTTGG - Intergenic
1179881611 21:44295428-44295450 GAAGGGGACAGTGACAGCTGTGG - Intronic
1181812274 22:25410789-25410811 GAAGTGGAGGATGACAGCTGAGG - Intergenic
1182043871 22:27259404-27259426 AAGGACGAAATTGAAAGCTGAGG - Intergenic
1182398417 22:30054770-30054792 CAGCTGGAGATTGACAGCTAAGG - Intergenic
1182900618 22:33895272-33895294 GAGGAGGAGATGGAGACCTGAGG + Intronic
1183010230 22:34940257-34940279 GAGTAGGAGTTTGATAGGTGAGG - Intergenic
1183269701 22:36853466-36853488 GAGGAGGAGACTTAGACCTGCGG + Intergenic
1183301799 22:37062417-37062439 GGAGAGGAGATTGACGGGTGGGG - Intronic
1183442218 22:37829783-37829805 GAGAATGAGAATGAGAGCTGTGG + Intergenic
1183962132 22:41417944-41417966 GAGGAAGCGAGTGACTGCTGAGG + Intergenic
1184460460 22:44634928-44634950 CAGGGGGACAGTGACAGCTGTGG - Intergenic
1185411275 22:50684205-50684227 GAGGATGAGCTTGGCAGCTTGGG + Intergenic
949608649 3:5681322-5681344 AAGGAGATGATTGACAGCTCAGG + Intergenic
950033418 3:9866972-9866994 GAGGAGGAGCTGGAAACCTGGGG - Exonic
950723199 3:14899097-14899119 AATGAGGAGATGGCCAGCTGAGG - Intronic
951460724 3:22948927-22948949 GTGGAGGAGATGGCCATCTGTGG - Intergenic
951851448 3:27145750-27145772 GATGAGGAGACTGAGTGCTGTGG + Intronic
952746528 3:36787089-36787111 GAGTAGGAGTTAGACAGATGGGG - Intergenic
953734387 3:45479324-45479346 GTGGAGGAGAGTGACACATGTGG + Intronic
954314008 3:49791375-49791397 GAGGAGGAGATACTCAGATGGGG + Intronic
955406313 3:58627716-58627738 GAGGAGGAGAGTGACTGCCGGGG - Intergenic
955415619 3:58688583-58688605 CAGTAGGAGAATGACAACTGAGG - Intergenic
956352475 3:68352872-68352894 GAGGAGGTAAATGACAGATGTGG - Intronic
956376412 3:68618042-68618064 GAGGAGGGCCTTGACAGATGTGG - Intergenic
957930078 3:86866031-86866053 GAGGAGGAAAGTGTAAGCTGGGG + Intergenic
960053394 3:113258686-113258708 GGGAAGGAGATTTGCAGCTGGGG + Intronic
961091325 3:124115045-124115067 GAGGAGGAGAATTTCAGCTGTGG + Intronic
961134378 3:124496318-124496340 GTGGAGGATATTGACAGCCAGGG + Exonic
962278859 3:134035492-134035514 GAGGAGGAGATTGTCAAGCGGGG + Intronic
963311907 3:143718934-143718956 GAGGAAGAGACTGACAACTGAGG - Intronic
966897516 3:184456878-184456900 GAGGAAGATATTCCCAGCTGGGG + Intronic
966934045 3:184694159-184694181 GGGGAGGAGATTATCACCTGGGG - Intergenic
966939954 3:184739757-184739779 GAGTAGGAGTTTGCCAGGTGGGG - Intergenic
970243024 4:14029220-14029242 GAGGAGGAGAGAGACAGGAGGGG + Intergenic
971503708 4:27343882-27343904 GATGAGGAGATTGAAAGCCAGGG + Intergenic
971711728 4:30121771-30121793 GAGAAGGAGATTGACTGCAAAGG - Intergenic
972055017 4:34790741-34790763 GAGGAAGAAATTGACAGTTATGG + Intergenic
972817154 4:42657043-42657065 GAGGAGGAGAAAGGCAGCGGTGG + Exonic
972849019 4:43025657-43025679 AATGAAGAGATTGACTGCTGCGG - Intronic
973723411 4:53748507-53748529 GAGCAGGACATGGCCAGCTGGGG + Intronic
975719397 4:77235292-77235314 GAAGAGAAGATGCACAGCTGAGG - Intronic
975727301 4:77304438-77304460 CAGGATGAGATTGAAATCTGTGG + Intronic
977007939 4:91595656-91595678 GATGAGGAAATTGGCAGCTTAGG + Intronic
978729066 4:112003709-112003731 GTGGAGGTGATTCAGAGCTGGGG - Intergenic
979234912 4:118388573-118388595 GAAGAGGAGAGTGAATGCTGGGG - Intergenic
980179635 4:129388172-129388194 GAAGAGAAGATTTACAACTGGGG - Intergenic
982174038 4:152688712-152688734 GAGAAGGAGATTGAAAGCTGAGG + Intronic
983183925 4:164679551-164679573 GAGGAGAAGATTGAGAGCAGGGG - Intergenic
983998318 4:174212565-174212587 GAGGAGGAGAATGAGACCTCAGG + Intergenic
984637160 4:182123876-182123898 GAGGAGAAGAGTGACAGCGTGGG + Intergenic
984646736 4:182228082-182228104 GAGGAGGAAATGGAGAGATGTGG + Intronic
985856256 5:2429617-2429639 GAGGAGGAGAATGGATGCTGTGG + Intergenic
986029166 5:3879799-3879821 GAGGAGGAGAAGGAGAGTTGGGG - Intergenic
986142262 5:5041649-5041671 GGGGAGGAGGTGGACAGCAGTGG + Intergenic
987302105 5:16606287-16606309 GAGAAGGAGAGTGGCAGCAGAGG - Intronic
988887559 5:35574513-35574535 GATGAGGAGACTGACAGCTGGGG + Intergenic
990346967 5:54880913-54880935 GAGGAGGAGATGGGAAGCTGAGG - Intergenic
995026912 5:107434339-107434361 GTTGTGGATATTGACAGCTGGGG + Intronic
995292188 5:110469697-110469719 GCTGAGGGGATTGACAGCTCTGG - Intronic
997281149 5:132646786-132646808 CAGGAGGTGAGTGACAGGTGAGG - Intergenic
999135530 5:149316282-149316304 GAGGAGGAGGTTCCCTGCTGTGG + Exonic
999887392 5:155937892-155937914 GATGAGAAGAGTGAAAGCTGAGG + Intronic
1000576198 5:162978297-162978319 AGGGAGGAAAATGACAGCTGTGG + Intergenic
1001949751 5:175808020-175808042 GAAGAGGAAATAGAGAGCTGGGG + Intronic
1002139535 5:177130646-177130668 CAAAAGGAGATTGGCAGCTGGGG - Intergenic
1002196273 5:177503357-177503379 GATGAGGAGACTGACGCCTGGGG + Intronic
1002875158 6:1203756-1203778 GAGAATGATATTGACAGCTGGGG + Intergenic
1003311023 6:4970069-4970091 GAGGAGGAGATTAGAAGATGAGG + Intergenic
1003746092 6:9004273-9004295 AAGGAAGTGATTGGCAGCTGAGG + Intergenic
1003941923 6:11037219-11037241 GAGGAGGAGAGAGACAGAGGAGG + Intronic
1006116204 6:31777317-31777339 GCGGAGGTGAGTGAGAGCTGGGG + Intergenic
1006687167 6:35845315-35845337 GAGCAGCAGATCGACAGTTGGGG + Intronic
1008518166 6:52337877-52337899 GTAGAGGAGATTTACAGCTGTGG - Intergenic
1008654872 6:53601660-53601682 GAGTAGGATATTGAGCGCTGAGG - Intronic
1009842409 6:69093440-69093462 AAGGAGGAGATAGACAGCCTAGG + Intronic
1010935168 6:81851742-81851764 GAGGAGAAGACAGACACCTGAGG + Intergenic
1012019528 6:93900155-93900177 GAGGAGGTGATTAATAGTTGAGG + Intergenic
1012258414 6:97060539-97060561 GAGGAGGAGAATGGGACCTGAGG - Intronic
1013349356 6:109291539-109291561 GTGGAAGAAATTCACAGCTGAGG - Intergenic
1013736660 6:113235135-113235157 GAGGAGAAGCTTCACAGGTGAGG - Intergenic
1017487506 6:154916884-154916906 GAGGATGAAATGGACAGCAGTGG + Intronic
1017772087 6:157651362-157651384 GAGGAAGAGAATGCCAGGTGAGG - Intronic
1021122243 7:16809441-16809463 GAGGAGCAGATTTACTGCTTGGG + Intronic
1022494241 7:30843317-30843339 GAGGAGGAGGGTGGGAGCTGGGG + Intronic
1023093533 7:36638397-36638419 GAGGAGGTGACTGAGAGATGAGG - Intronic
1024541250 7:50476545-50476567 GAGGAGATGTGTGACAGCTGTGG + Intronic
1025228289 7:57181997-57182019 GAGGAGGAAATAGCCAGGTGTGG - Intergenic
1025228447 7:57182800-57182822 GAGGAGGAAATAGCCAGGTGTGG - Intergenic
1025228488 7:57182994-57183016 GAGGAGGAAACAGACAGGTGAGG - Intergenic
1026567335 7:71500482-71500504 GAGGAGGAAGTTGAGACCTGGGG - Intronic
1026996020 7:74617273-74617295 GAGGAGCAGAGTGACAGCTGTGG + Intergenic
1028222549 7:88214393-88214415 GAGGAGGAGAGGGACAGATCAGG + Intronic
1028421843 7:90641653-90641675 GGGTGGGGGATTGACAGCTGTGG + Intronic
1030142029 7:106314554-106314576 GAAGAGGAGATTGACAGAAAGGG - Intergenic
1031007232 7:116487241-116487263 CAGGAGGAGATGGAAAGCTCGGG + Intronic
1031128819 7:117807118-117807140 GAGTTGGAGATTGAGATCTGTGG - Intronic
1034437107 7:151067967-151067989 GAGGAGGAGACTGAGCGCTGGGG + Exonic
1034760063 7:153663608-153663630 CACAAGGAGAGTGACAGCTGGGG + Intergenic
1034791810 7:153977348-153977370 GAAGAGGAGGTGCACAGCTGTGG + Intronic
1035243751 7:157549070-157549092 TAGCAGGAGATTGACAGATGTGG - Intronic
1036406593 8:8460750-8460772 GAGGAGGAAACTGACAATTGAGG - Intergenic
1036825420 8:11972016-11972038 GAGAGTGAGATTGACACCTGTGG + Intergenic
1037290564 8:17345428-17345450 GAGGAGCAGAGTGACAGCCAGGG - Intronic
1037703495 8:21295996-21296018 GAGAGGGAGAGTGAGAGCTGGGG - Intergenic
1037703502 8:21296020-21296042 GAGAGGGAGAGTGAGAGCTGGGG - Intergenic
1038001658 8:23396971-23396993 GAGGAGGAGATAAACAAATGTGG + Intronic
1038338146 8:26661900-26661922 GAGGACTAGATGGACAGCTTTGG - Intergenic
1038703924 8:29876679-29876701 GAGGAGGTGAGTGAAAGGTGTGG - Intergenic
1039273330 8:35907097-35907119 GTGGAGGAGAGTGACTGCTAAGG - Intergenic
1040478909 8:47805931-47805953 GTGTGGGAGATTGACAGCTCTGG - Intronic
1040742016 8:50587752-50587774 GAGGCGGAGATTGCCAGCCTGGG + Intronic
1041102273 8:54408308-54408330 GAGGAGGGGAGGGAGAGCTGGGG + Intergenic
1041325490 8:56659099-56659121 GAGGAGGAAGTTGGCTGCTGGGG + Intergenic
1041730399 8:61056625-61056647 AAGGAGGTGATTCACAGGTGTGG - Intergenic
1043868032 8:85398039-85398061 GTGAAGGAGGCTGACAGCTGGGG + Intronic
1044082494 8:87903056-87903078 GGGGAGGAGATTGAAAACAGGGG + Intergenic
1044283849 8:90388280-90388302 GAGGAAGGGATTGATAGATGGGG - Intergenic
1046567675 8:115921596-115921618 AACAAGGAGATTGAAAGCTGAGG - Intergenic
1048281025 8:133105840-133105862 GAGGAGGAGATGGAGAGGTGGGG + Intronic
1048447860 8:134505404-134505426 GATGAGGACATGGACAGCTTTGG - Intronic
1049045864 8:140151089-140151111 GAAGTGGAGATTGACAGCAGGGG + Intronic
1049280131 8:141740008-141740030 GAGGATGAGATGGACAGCGGCGG - Intergenic
1050650387 9:7769389-7769411 GAAGAAGAGATTCACAGATGGGG - Intergenic
1050678789 9:8086008-8086030 GAGCAGGAGATTGAATGCAGAGG - Intergenic
1051446156 9:17141499-17141521 AAGGAGGAAAGTGACAGATGAGG + Intronic
1051731176 9:20144598-20144620 GAGGAGGAGATGGATGGCAGAGG + Intergenic
1052328814 9:27246047-27246069 GGGAAGGAGATACACAGCTGAGG - Intergenic
1052820310 9:33133241-33133263 GAGTAGAAGACAGACAGCTGTGG - Intronic
1055033356 9:71792719-71792741 GAGGAGGACAGTGAAGGCTGAGG + Intronic
1055573676 9:77642047-77642069 GAGCAGGAGATTGACTGCAAAGG + Intronic
1055684886 9:78761620-78761642 TAGGAGGAGATTCTCAGCTATGG + Intergenic
1056378607 9:86037320-86037342 AAGGAGGTGATTTCCAGCTGAGG + Intronic
1057115281 9:92514926-92514948 GAGGAGGAGACAGAAAGCAGAGG - Exonic
1057250430 9:93496734-93496756 GAGGAGGATGTGGACAGCTTTGG + Intronic
1058387244 9:104452001-104452023 GAGCAGGGGATTGAGAGTTGTGG + Intergenic
1059295471 9:113266260-113266282 GAGGGGGAGAGGGACAGGTGTGG - Intronic
1059616042 9:115951717-115951739 GAGAAGAAGATTGAGAGCTATGG - Intergenic
1059652888 9:116332358-116332380 CAGGTGGACAATGACAGCTGCGG - Exonic
1059752525 9:117261650-117261672 GTGGAGGAGATAGAAAGCAGAGG - Intronic
1060755025 9:126206326-126206348 GAGGGGGTGATTGGCAGGTGCGG + Intergenic
1061790899 9:133058294-133058316 GAGGTGGAGCTGGGCAGCTGTGG + Exonic
1185886383 X:3787063-3787085 GAGGAGGAAATGAACAGATGAGG - Intergenic
1186013402 X:5163748-5163770 GTGGAGGAGATTTGCATCTGTGG + Intergenic
1187652346 X:21422374-21422396 CAGGAAGAGATTGACAGCTGAGG - Intronic
1188051912 X:25498017-25498039 AAGAAGGAGACTGACAGATGAGG + Intergenic
1191740492 X:64432393-64432415 GGGCAGGAGATTCATAGCTGAGG - Intergenic
1192079441 X:68032953-68032975 GAGGGGGAGAGTGCCAGGTGGGG - Intergenic
1192417979 X:71001491-71001513 GAGTAGGACATTGTCAGGTGAGG - Intergenic
1193968185 X:88016102-88016124 GAGGAGGATATTGACAGTAAGGG + Intergenic
1194744336 X:97611941-97611963 GATCAGAAGATTGAAAGCTGTGG - Intergenic
1195801187 X:108712863-108712885 GAGGTGGTGAATGACAGTTGGGG - Intergenic
1200021907 X:153218847-153218869 CAGGAGTAGACTGACAGCTAGGG + Intergenic
1200297282 X:154933321-154933343 GAGGAGGAGATTGACAGCTGAGG - Intronic
1200934834 Y:8729285-8729307 GAGCAGGAGATTCACATCTTGGG - Intergenic
1201328039 Y:12787178-12787200 GAGAAAGAGATTCACAGTTGTGG - Intronic
1201849455 Y:18461986-18462008 GAGGAGGAGATTGACATTCCAGG + Intergenic
1201883863 Y:18858389-18858411 GAGGAGGAGATTGACATTCCAGG - Intergenic