ID: 1200297283

View in Genome Browser
Species Human (GRCh38)
Location X:154933337-154933359
Sequence CCTATGTCAGAAGTTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297283_1200297287 -9 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297283_1200297289 1 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297283_1200297290 2 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297290 X:154933362-154933384 TAAGCTATCTGGCCAAGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1200297283_1200297288 0 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297288 X:154933360-154933382 TATAAGCTATCTGGCCAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297283 Original CRISPR CCTATGTCAGAAGTTGGAGG AGG (reversed) Intronic
900106009 1:981424-981446 GCTCTGGCAGAAGGTGGAGGAGG - Intronic
911793545 1:102047990-102048012 CCCAAGCCAGGAGTTGGAGGAGG + Intergenic
915557046 1:156666627-156666649 CCTGTGCCAGACGGTGGAGGAGG - Intergenic
917296434 1:173524024-173524046 TATATGTCAGGAGTTGGGGGTGG + Exonic
919567950 1:199212639-199212661 CCAATGTCAGAAATAGGAGGCGG + Intergenic
919754614 1:201059026-201059048 CCTGTGTCTGAAGGTGGAAGTGG + Intronic
919770042 1:201152262-201152284 CCTACCTAAGAAGTTGGAGAAGG - Intronic
921928454 1:220732914-220732936 CCCATGTCCGAAGTAGGAGAAGG - Intergenic
1063906057 10:10781448-10781470 TCTATGGCAGAAGGTGAAGGAGG + Intergenic
1067663918 10:48257071-48257093 CAGATGGCAGAAGCTGGAGGAGG - Intronic
1071140134 10:82500114-82500136 CATATGCTAGAACTTGGAGGAGG + Intronic
1072569949 10:96649851-96649873 CAGATGTCAGTAGGTGGAGGGGG - Intronic
1073222557 10:101887871-101887893 ACTTTGAAAGAAGTTGGAGGAGG + Intronic
1078296452 11:10076290-10076312 CTTCTGTCAGTAGTTGGAGACGG - Intronic
1079689922 11:23405825-23405847 CCTACAGCAGAAGCTGGAGGAGG + Intergenic
1079847795 11:25491729-25491751 ACTATGCCAAAAGTTTGAGGAGG - Intergenic
1080168122 11:29265086-29265108 CATAGGTCAGAAGTAGGAAGAGG + Intergenic
1081071045 11:38608662-38608684 CTCATGGCAGAAGGTGGAGGGGG + Intergenic
1081362239 11:42194517-42194539 CATATGTCAGCATTTGGGGGTGG + Intergenic
1082795849 11:57377335-57377357 CCCATGTCTGCTGTTGGAGGTGG + Intronic
1082831944 11:57624939-57624961 ACTATGTCTAAAGATGGAGGAGG - Intergenic
1083157358 11:60832380-60832402 GCTATGTGAGAAGCTGCAGGTGG + Intergenic
1084235033 11:67782265-67782287 ATTATGGCAGAAGGTGGAGGAGG - Intergenic
1085770457 11:79321048-79321070 TCTATCTCAGAAGTAGAAGGAGG + Intronic
1085831758 11:79908821-79908843 ACTTTGTCAGGAGTTGTAGGTGG - Intergenic
1086024228 11:82270615-82270637 CTTATGGCAGAAGGTGAAGGAGG - Intergenic
1087470806 11:98571870-98571892 CCTATGAGAGAAATTAGAGGAGG - Intergenic
1089929625 11:122297289-122297311 ATCATGTCAGAAGGTGGAGGGGG + Intergenic
1089978102 11:122750228-122750250 CCTATCTCAACAGTGGGAGGAGG - Intronic
1091279168 11:134372247-134372269 CTTATCTCAGATGTTGGGGGAGG + Intronic
1091298487 11:134489801-134489823 GCTATGTCAGAAGTTGTCTGAGG - Intergenic
1096908301 12:54956821-54956843 CCCATGGCGGAAGATGGAGGGGG + Intronic
1096979189 12:55718676-55718698 TCTATGCAAGAAGTTGGAGAGGG - Intronic
1100214813 12:92436538-92436560 ACTAAGTTAGAAGTTGGAGATGG + Intergenic
1100921725 12:99495911-99495933 CCTATTTCAGATGTTGCAGAAGG + Intronic
1101082187 12:101198735-101198757 ACTATTTCAGAAAATGGAGGAGG + Intronic
1101611939 12:106300918-106300940 GCTATGACATAAGTTGGAGCAGG - Intronic
1102348789 12:112176794-112176816 CCTAAGCCCTAAGTTGGAGGAGG - Intronic
1102638662 12:114346842-114346864 CCTATGTCTGAAATTAGAGGTGG + Intergenic
1105018593 12:132801563-132801585 CCCATGTCAGAAGGTTGGGGGGG + Intronic
1105446023 13:20457782-20457804 CCCATGTCAGCACTTGGAGCAGG - Intronic
1106582098 13:31027483-31027505 CCCATGACAAAGGTTGGAGGTGG + Intergenic
1112112028 13:96311656-96311678 CATATGTCACATATTGGAGGTGG + Intronic
1113205083 13:107907674-107907696 CCCATGGCAGAAGGTGAAGGGGG - Intergenic
1115634038 14:35273966-35273988 ACTATGCCAGAAATGGGAGGAGG - Exonic
1115672388 14:35628962-35628984 CCAATGTCAGAATCTGAAGGAGG + Intronic
1116797537 14:49407958-49407980 CATCTCTCAGAAGCTGGAGGTGG - Intergenic
1118166261 14:63339464-63339486 CCTATGTTGGAAGTTGGACCTGG - Intergenic
1119927705 14:78512078-78512100 CATATGACAGAAGTTGCAAGGGG - Intronic
1120833838 14:89022683-89022705 CCTAGATCAGAATTTGGAGTGGG - Intergenic
1122322509 14:100863893-100863915 GCTTTGTCAGAGGTTGGAGCTGG - Intergenic
1122541124 14:102498146-102498168 TCTTTGTCAGCCGTTGGAGGAGG - Exonic
1123100013 14:105791316-105791338 ACCATGGCAGAAGTTGAAGGGGG - Intergenic
1123937146 15:25199532-25199554 CCTAGGTGAGAATTTGGAAGAGG + Intergenic
1124205803 15:27719040-27719062 CTCATGTCAGAAGTTGGGGCTGG - Intergenic
1124597414 15:31102458-31102480 CCTCTGTGAGAAGCGGGAGGCGG - Intronic
1128443355 15:67735194-67735216 CCTATGCCAGAAACAGGAGGTGG + Intronic
1128807246 15:70540177-70540199 CCTATGGCTGCAGTGGGAGGGGG - Intergenic
1131218670 15:90562309-90562331 CCTATCTCAGAAGGTTGATGTGG - Intronic
1132600758 16:771773-771795 GCAATGCCAGAAGCTGGAGGAGG + Intronic
1132791186 16:1689540-1689562 CTGAGCTCAGAAGTTGGAGGCGG - Intronic
1135187627 16:20328820-20328842 GCCTTATCAGAAGTTGGAGGGGG - Intergenic
1136672470 16:31871113-31871135 GCTATGGCAGAATTTGAAGGTGG - Intergenic
1138188558 16:54995897-54995919 CCTGTGGGAGAAGTAGGAGGTGG + Intergenic
1140134785 16:72196424-72196446 CACATGTCAGAGGTTGGGGGAGG - Intergenic
1142596515 17:1032253-1032275 CCTGGGGCAGAAGTTGGGGGTGG - Intronic
1144513087 17:15894382-15894404 TCGGTGTCAGAAGGTGGAGGAGG + Intergenic
1147765283 17:42830963-42830985 CCCAGGCCATAAGTTGGAGGTGG + Intronic
1149289802 17:55207030-55207052 CCACTGTGAGAAGTTGCAGGAGG - Intergenic
1150953178 17:69824863-69824885 TCCATTTTAGAAGTTGGAGGAGG + Intergenic
1151765720 17:76132350-76132372 CCTGCGTCAGAAGTTGGCAGGGG - Intergenic
1152297225 17:79475129-79475151 CCGATCTCAGCAGTGGGAGGTGG + Intronic
1153765578 18:8371738-8371760 CCTATGTCAGCAGAAAGAGGGGG - Intronic
1156489406 18:37487389-37487411 CCTGAGGCAGGAGTTGGAGGTGG - Intronic
1158054863 18:53266683-53266705 CCTATGGCTGAAGTGTGAGGAGG - Intronic
1158971108 18:62667447-62667469 CTTTTGTCAGAGGTTGGAAGTGG + Intergenic
1159077671 18:63700081-63700103 CCCTTGTCACAAGTTAGAGGAGG - Intronic
1160449207 18:78950608-78950630 CCTCTGCCAGAAGCTGGAGAGGG + Intergenic
1160896762 19:1406683-1406705 CCAATGTCAGCAGAAGGAGGTGG - Intergenic
1163152639 19:15424289-15424311 CCTACAGCAGAAGCTGGAGGAGG - Exonic
1164401191 19:27903429-27903451 CCAATGTCAGGGGTTGAAGGTGG - Intergenic
1164429299 19:28172863-28172885 CTCATGGCAGAAGGTGGAGGAGG - Intergenic
1164858548 19:31544337-31544359 CTCATGGCAGAAGGTGGAGGGGG + Intergenic
1165795935 19:38519165-38519187 CCTGTGTCAGAGGCCGGAGGTGG + Intronic
1166781986 19:45347799-45347821 CCTATCTCAGAAGTTAGCGTGGG + Intronic
1167022262 19:46886414-46886436 CCTATGTCAGAATTAGAAGTAGG - Intergenic
927041174 2:19231870-19231892 TCTATGCCAGAAGTTGGATTAGG + Intergenic
927076883 2:19587533-19587555 CCTATCTCAAAGATTGGAGGAGG + Intergenic
928686963 2:33759740-33759762 CCTATCTCAGAAGCTGGAAAAGG + Intergenic
930309474 2:49720525-49720547 CTTCTGTCAGAAGTTTAAGGGGG - Intergenic
931704479 2:64935993-64936015 CTCATGGCAGAAGGTGGAGGGGG - Intergenic
933035697 2:77394763-77394785 CCTATGTCAAAAGGTGAAGCAGG + Intronic
935836923 2:107064803-107064825 CTTATGTCACAAGTTTGCGGGGG - Intergenic
937013560 2:118583115-118583137 CCCATGTGAAAAGCTGGAGGAGG + Intergenic
938613845 2:132977445-132977467 CCTATGTGAGAAGATGCATGTGG - Intronic
942593001 2:177566003-177566025 GCTATTTCTGATGTTGGAGGAGG + Intergenic
944556389 2:200891507-200891529 TTTATTTAAGAAGTTGGAGGGGG + Intronic
946191685 2:218010922-218010944 CCAGGGTCAGAGGTTGGAGGTGG - Intergenic
947537218 2:230947852-230947874 GCTATGTTAGGAGTTGGAGGGGG - Intronic
1168955797 20:1833320-1833342 CCTATCTGTGAAGTGGGAGGTGG - Intergenic
1169313568 20:4569202-4569224 CTTATGGCAGAAGGTGGAGCCGG + Intergenic
1170446551 20:16433955-16433977 CCTGTGTCTGGAGTTGGGGGAGG - Intronic
1170616419 20:17956111-17956133 TCTTTGTCATAAGTTGGGGGTGG - Intronic
1174341475 20:49899542-49899564 CCTATGTGAGGAGGAGGAGGCGG - Intergenic
1174832964 20:53830477-53830499 CCCATGTCTGATGATGGAGGGGG - Intergenic
1175614290 20:60380055-60380077 ACTATGTGAGAAGAGGGAGGAGG + Intergenic
1179440724 21:41391978-41392000 GATCTGTCAGAAGGTGGAGGAGG - Intronic
1182778897 22:32851608-32851630 CCTCTGTCAGAAGTAAGACGAGG - Intronic
1183105424 22:35611820-35611842 CCAAGGTCTAAAGTTGGAGGTGG - Intronic
951479790 3:23148166-23148188 TCTGAGTCAGAAATTGGAGGTGG + Intergenic
951844164 3:27067631-27067653 CCTATATCAGAAGTTCCAGCAGG + Intergenic
954764748 3:52904429-52904451 ATTATGACAGAATTTGGAGGGGG - Exonic
956994911 3:74814959-74814981 CCTATGGCAGGACCTGGAGGTGG - Intergenic
960837874 3:121926245-121926267 CCAATGTTGGATGTTGGAGGTGG + Intronic
961884675 3:130088794-130088816 ATTATGGCAGAAGGTGGAGGAGG - Intronic
962478882 3:135781302-135781324 ACTGAGCCAGAAGTTGGAGGTGG + Intergenic
962575180 3:136749838-136749860 CATAGGTCAGAAGTTTGGGGAGG - Intronic
968531526 4:1094389-1094411 CCTGCGTCAGAAGCTGGGGGTGG + Intronic
968532605 4:1101689-1101711 CCTATGGCAGGAGCTGGAGGAGG - Intronic
969820108 4:9713494-9713516 ATTATGGCAGAAGGTGGAGGAGG + Intergenic
970111782 4:12645693-12645715 ATTATGGCAGAAGGTGGAGGAGG - Intergenic
972258953 4:37388887-37388909 CCCATATCAGGAGCTGGAGGAGG - Intronic
972559856 4:40217160-40217182 CCTCTGTCAGATGTGGCAGGAGG + Intronic
973722020 4:53733681-53733703 CATATTTTAGATGTTGGAGGAGG - Intronic
979541486 4:121888691-121888713 ACTATTACAGAACTTGGAGGTGG - Intronic
983816855 4:172140502-172140524 CCTATGTCAGAAGGTATATGAGG - Intronic
984698692 4:182804519-182804541 CCCATTCCAGAAGCTGGAGGTGG + Intergenic
985815910 5:2127752-2127774 CCTCTGTCAGAAGTGGAAGATGG - Intergenic
986338322 5:6770647-6770669 CCTTTGTGAGAAGTGGGAGGGGG - Intergenic
987553370 5:19412949-19412971 CCAATGTTAGAAGTTGGACCTGG + Intergenic
991730220 5:69579295-69579317 CTTATGTCAGTATTTAGAGGAGG + Intronic
991806655 5:70434453-70434475 CTTATGTCAGTATTTAGAGGAGG + Intergenic
991864732 5:71048553-71048575 CTTATGTCAGTATTTAGAGGAGG - Intronic
995092606 5:108195730-108195752 ACTGTGACAGCAGTTGGAGGTGG + Intronic
999935115 5:156478242-156478264 CCTATATCAGAAATTCGAGTGGG + Intronic
1002151695 5:177238384-177238406 GCTCAGTCAGAACTTGGAGGTGG + Exonic
1002653793 5:180725365-180725387 CCTTTTTCAGATGTTAGAGGTGG + Intergenic
1002703878 5:181147594-181147616 CCTATGTGGGCAGTGGGAGGCGG + Intergenic
1005168709 6:22956430-22956452 GCAATGTCAGATGGTGGAGGTGG - Intergenic
1007018751 6:38497276-38497298 CCTGTGACAGCAGTGGGAGGTGG - Intronic
1007098851 6:39230962-39230984 CACCAGTCAGAAGTTGGAGGGGG + Intergenic
1007195235 6:40055002-40055024 CCTATGTAAGAAGTTAGGTGAGG + Intergenic
1008645117 6:53505831-53505853 CCAATGTCTGAGTTTGGAGGAGG + Exonic
1010024293 6:71197786-71197808 TCAATGTCAGGTGTTGGAGGAGG - Intergenic
1010855445 6:80832833-80832855 CCTATCTTAGAAGTTGCTGGAGG - Intergenic
1011334925 6:86249969-86249991 GTTATGGCAGAAGGTGGAGGGGG - Intergenic
1011587595 6:88943448-88943470 CCTAAATCAGATGTTGGTGGAGG - Intronic
1011954185 6:93004841-93004863 CAGAAGTCAGAAGTTGCAGGGGG + Intergenic
1012894627 6:104934490-104934512 ATTCTTTCAGAAGTTGGAGGTGG + Intergenic
1013884255 6:114942941-114942963 TCCAAGTCAGAACTTGGAGGTGG - Intergenic
1018252566 6:161885857-161885879 TCTATGTCCCAAGTTTGAGGAGG + Intronic
1018780536 6:167059886-167059908 CCTTTTCCAGAGGTTGGAGGGGG + Intergenic
1020318053 7:6920805-6920827 ATTATGGCAGAAGGTGGAGGAGG - Intergenic
1021291901 7:18855700-18855722 CATAGGTCAGAAGGTGGAGAGGG + Intronic
1022189491 7:28003593-28003615 CCTATGTCAGTGTTTGTAGGTGG - Intronic
1026277345 7:68891659-68891681 CCCATGGCAGAAGGTGAAGGGGG + Intergenic
1029734406 7:102457606-102457628 GCTATGCCAGGAGGTGGAGGTGG - Exonic
1032125678 7:129190623-129190645 CCTTTGTCAGATGTTGGACAAGG + Intronic
1035085299 7:156253036-156253058 CCTAAGTCAGAAGGAGGAGCAGG + Intergenic
1037494591 8:19426294-19426316 CCTCTTTCTGATGTTGGAGGTGG - Intronic
1037936263 8:22917031-22917053 CCAATGCCAGAATATGGAGGTGG + Intronic
1040824076 8:51598775-51598797 CCTATGTTAGAAAATCGAGGAGG - Intronic
1041992814 8:64014617-64014639 TGTATGTCAAAATTTGGAGGTGG + Intergenic
1048924659 8:139260795-139260817 CATATGTCACAAGTTGGTGCTGG - Intergenic
1048990728 8:139758686-139758708 CTTGTGTCAGAAGGTGAAGGCGG + Intronic
1049391449 8:142373632-142373654 CCTGTGTCAGAGGTAGAAGGAGG - Intronic
1050019002 9:1264426-1264448 TCTATACCAGCAGTTGGAGGTGG + Intergenic
1055098029 9:72434432-72434454 CCTGTCTCAGATGTTGGAGAAGG + Intergenic
1055690558 9:78826047-78826069 CATATGTCAGAAGTTTGAACTGG - Intergenic
1056822618 9:89854190-89854212 GCTGTGGCTGAAGTTGGAGGTGG + Intergenic
1057899200 9:98934803-98934825 CATTTGTCAGATGTTGGATGGGG + Intergenic
1059993431 9:119886643-119886665 CCTATCTCAGAGGTTTGTGGTGG - Intergenic
1060650664 9:125323848-125323870 TCTGTGTCAGAACTTGGAGCAGG + Exonic
1061040350 9:128138094-128138116 GCTGTGGCTGAAGTTGGAGGTGG - Intergenic
1188827571 X:34855190-34855212 CCTATGACAGGAGTTGGGGTGGG - Intergenic
1192326598 X:70137672-70137694 CCTTTGTAAGAAGTTGAGGGCGG + Intronic
1192572888 X:72221130-72221152 CCATTGTGGGAAGTTGGAGGTGG - Intronic
1192894644 X:75429011-75429033 ACAATGTCACAAGTTGGAGTGGG + Intronic
1193388329 X:80896150-80896172 ATTATGGCAGAAGGTGGAGGAGG - Intergenic
1196989123 X:121308457-121308479 TCCATGACAGAAGTTGGGGGAGG - Intergenic
1198218650 X:134579693-134579715 CTTGTGTCACAAGTTGGAGAGGG + Intronic
1198454269 X:136800410-136800432 GCTAGGACAGGAGTTGGAGGGGG + Intergenic
1200297283 X:154933337-154933359 CCTATGTCAGAAGTTGGAGGAGG - Intronic