ID: 1200297285

View in Genome Browser
Species Human (GRCh38)
Location X:154933340-154933362
Sequence ATACCTATGTCAGAAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297285_1200297290 -1 Left 1200297285 X:154933340-154933362 CCTCCAACTTCTGACATAGGTAT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1200297290 X:154933362-154933384 TAAGCTATCTGGCCAAGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1200297285_1200297288 -3 Left 1200297285 X:154933340-154933362 CCTCCAACTTCTGACATAGGTAT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1200297288 X:154933360-154933382 TATAAGCTATCTGGCCAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1200297285_1200297289 -2 Left 1200297285 X:154933340-154933362 CCTCCAACTTCTGACATAGGTAT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297285 Original CRISPR ATACCTATGTCAGAAGTTGG AGG (reversed) Intronic
904845201 1:33407461-33407483 CTATCTATGTCAAAAGTTTGAGG + Intronic
905921265 1:41720494-41720516 ATTCCTATGTGAGGAGTTGAGGG + Intronic
908897111 1:68912804-68912826 AGACCTATCCCTGAAGTTGGGGG - Intergenic
910532931 1:88261159-88261181 ATCACTATCTCAGAAGTTGCTGG + Intergenic
917816725 1:178718155-178718177 ATACCTATGTGTGAAATTGCTGG + Intergenic
918593541 1:186266524-186266546 ATACCAATATGAGAGGTTGGTGG - Intergenic
919567948 1:199212636-199212658 ATTCCAATGTCAGAAATAGGAGG + Intergenic
924231354 1:241964603-241964625 ATGCCTATGTGAGAAATTTGGGG - Intergenic
1064871623 10:19944292-19944314 ATTTTCATGTCAGAAGTTGGAGG - Intronic
1064902548 10:20311062-20311084 ATACTCATGGCAGAAGTTGAAGG + Intergenic
1066175466 10:32899398-32899420 ATCCCTTTGTTGGAAGTTGGAGG - Intergenic
1067273634 10:44814890-44814912 ATAGCAATGTTGGAAGTTGGAGG - Intergenic
1068539782 10:58278903-58278925 ATACCTACATCAGCAGCTGGGGG - Intronic
1070495773 10:77020621-77020643 ATACCCATGTGAAGAGTTGGCGG - Intronic
1072229815 10:93405002-93405024 ATTCCTAAGTAAAAAGTTGGAGG - Intronic
1072521671 10:96235378-96235400 ATCCCCAGGTCAGAAATTGGAGG + Intronic
1072966531 10:99978523-99978545 ATATATATGTCAGAGTTTGGTGG - Intronic
1074852018 10:117446596-117446618 ATACCCATTTCAGAAGCTGATGG - Intergenic
1075927620 10:126265999-126266021 ATACATATGTCAGAATTTGCAGG + Intronic
1077799293 11:5522313-5522335 ATACCTGGCTCTGAAGTTGGTGG + Intronic
1078820437 11:14875050-14875072 ATACTTATTTCAGCACTTGGGGG + Intergenic
1083066905 11:59932867-59932889 ATATTTCAGTCAGAAGTTGGGGG + Intergenic
1083646965 11:64177462-64177484 ATTCATATGTCAGAAGTATGGGG - Intergenic
1084596749 11:70121077-70121099 ACACGTCTGTCAGAAGGTGGTGG + Intronic
1084713400 11:70858354-70858376 ATACCCATGTCTGAAGCTGCAGG + Intronic
1086484588 11:87285301-87285323 AAAACTATGTCTGAAATTGGTGG + Intronic
1090159622 11:124478949-124478971 ATCACGAGGTCAGAAGTTGGAGG + Intergenic
1090165164 11:124538807-124538829 GTACCTATGTCAGAAGCAGGTGG - Intergenic
1092317863 12:7439006-7439028 ATACCGATGTCAGAGGCAGGAGG - Intronic
1093454162 12:19348245-19348267 ATACCTATGTCACAATTACGTGG - Intronic
1095416551 12:41983405-41983427 ATAGATATGTCAGAAATGGGTGG - Intergenic
1099155786 12:79174260-79174282 ATACCCATCACAGAAGTTGTTGG + Intronic
1099612482 12:84891835-84891857 ATACCTATGTCAGAAGAATGGGG - Exonic
1100137339 12:91569718-91569740 ATACTTATTTCAGAATTTAGGGG - Intergenic
1105238778 13:18590604-18590626 ATACCTAAGAGAGAAGTTGCTGG + Intergenic
1105354552 13:19647041-19647063 ATACCGATGTCAGAGGCAGGAGG + Exonic
1108860996 13:54858492-54858514 ACAACCATGGCAGAAGTTGGAGG - Intergenic
1110242594 13:73285699-73285721 AGACCTAAGTGAGAAGTGGGAGG + Intergenic
1117706692 14:58477223-58477245 TTACCAATGTCAGAAGTCAGTGG - Exonic
1117878389 14:60280698-60280720 ATGCCTAAGGCAGAAGATGGGGG - Intronic
1120168562 14:81225962-81225984 ATTCCAATGTTAGCAGTTGGGGG - Intergenic
1122913676 14:104845941-104845963 ATAGCAATGCCAGAAGGTGGTGG + Intergenic
1125704994 15:41726297-41726319 ATACCTACCTCAGGAGTTGTTGG + Intronic
1130074290 15:80675377-80675399 ATACCTCTGTCACAATTTGTGGG + Intergenic
1131992197 15:98103297-98103319 ATTCCTATGTCCGGAATTGGTGG + Intergenic
1138812103 16:60163423-60163445 ATCCCTATGTCAGACATTGGTGG - Intergenic
1146423333 17:32711036-32711058 ATACCTAGGTGAAAAGTTGCTGG - Intronic
1154292269 18:13119383-13119405 ATACATCTGTCACAAATTGGAGG + Intronic
1154512182 18:15118440-15118462 ATACCTAAGAGAGAAGTTGCTGG + Intergenic
1157351783 18:46894417-46894439 ATACCAACATCAGAGGTTGGTGG - Intronic
1158942412 18:62417634-62417656 AAACCTAACTTAGAAGTTGGAGG + Intergenic
1159136673 18:64344887-64344909 ATACTTAGGTCATAAGTTGTTGG - Intergenic
1163459829 19:17430303-17430325 ATACCCAAGTCAGAAGCAGGTGG - Intronic
926807899 2:16728525-16728547 ATCCTTATGTAAGAATTTGGGGG + Intergenic
928623862 2:33119274-33119296 ATACCTTTGCCAGAAATTGAGGG + Intronic
931560008 2:63550844-63550866 ATTCTTATTTCAGGAGTTGGGGG - Intronic
931609779 2:64086665-64086687 ATACTTATTCCAGAATTTGGAGG + Intergenic
936276932 2:111107124-111107146 AGAACTATGGCAGAGGTTGGGGG + Intronic
936404994 2:112194961-112194983 TCACCAAGGTCAGAAGTTGGGGG + Intergenic
936479267 2:112869992-112870014 ATACATATGTGAGAAGTATGAGG + Intergenic
936613745 2:114027435-114027457 ATACATAGGTAAGAAGTTTGAGG + Intergenic
937214600 2:120303667-120303689 AGAACTGTGTCAGAAATTGGAGG - Intergenic
938511746 2:131955207-131955229 ATACCTAAGAGAGAAGTTGCTGG + Intergenic
939492484 2:142893224-142893246 ATACCTAAGTGAGAAGAAGGTGG + Intronic
940429404 2:153571120-153571142 ATACTGATGACAGAAGTTGAAGG - Intergenic
940705105 2:157094973-157094995 AGACTTATGTCAGAAGATGGTGG - Intergenic
942797972 2:179843511-179843533 ATACCTATGTCACAAGTATATGG - Intronic
943156020 2:184178159-184178181 ATTCAGATGTCAGAGGTTGGAGG + Intergenic
943914156 2:193606930-193606952 AAATCTATTTCAGAAGTTGAGGG - Intergenic
943937718 2:193943540-193943562 ATACCTATGTAGCAAGTGGGAGG - Intergenic
943943862 2:194033325-194033347 ATACCTAAGTAAGGAGGTGGAGG + Intergenic
1175148450 20:56913977-56913999 AAACCTAAATTAGAAGTTGGGGG + Intergenic
1177656970 21:24029899-24029921 ATACCCAAGTCAGAAGTTCTGGG + Intergenic
1180892782 22:19302603-19302625 ATACCTAGTTGAGAAGTTGCAGG - Intergenic
1182325776 22:29511567-29511589 AGACCTAAGTCAGAAGATGTTGG + Intronic
1183712768 22:39515419-39515441 ATTCCTATGGCAGACGCTGGAGG - Exonic
952744893 3:36767616-36767638 ATAGCTATGCCAAAGGTTGGTGG - Intergenic
953890678 3:46749955-46749977 ATACCTATGAGAGAGGATGGTGG + Intronic
956239030 3:67108365-67108387 ATGCCTATATCAGAAGAAGGTGG - Intergenic
956381884 3:68672855-68672877 ATACCTATGTGAGACGATGGTGG + Intergenic
960989742 3:123302742-123302764 ATACCTATGTCATAGGCTGTTGG + Intronic
961062523 3:123843594-123843616 AAACCTGTGTCAGAAGTTGGAGG - Intronic
963669367 3:148232327-148232349 ATTCCTATCTAAGGAGTTGGAGG - Intergenic
970047950 4:11877100-11877122 ACAATTATGTCAGAAGTTGAAGG + Intergenic
971132093 4:23822936-23822958 CTACCTTTGTTAGAAGGTGGTGG + Intronic
971599145 4:28569930-28569952 AGAGCTATGACAGAAGTTGCTGG - Intergenic
973077600 4:45948891-45948913 ATTGCTATCACAGAAGTTGGAGG + Intergenic
973595805 4:52488542-52488564 ATACATATGTCAAAATTTTGGGG + Intergenic
974850270 4:67395847-67395869 ATCCTTATCTCAGAAGATGGAGG + Intergenic
975421281 4:74167174-74167196 ATGCCTAGGTCAGCAGGTGGTGG - Intronic
978240866 4:106514785-106514807 CTAACTACATCAGAAGTTGGCGG - Intergenic
979078995 4:116311018-116311040 ATAGTTATGTTAGTAGTTGGTGG - Intergenic
985849716 5:2379916-2379938 ATATCTTTGTCAGCACTTGGTGG - Intergenic
988090314 5:26530921-26530943 ATACCTATATGAGGAGTTGTAGG - Intergenic
990845297 5:60131013-60131035 ATTCCTATGTCAGAATTAGTAGG + Intronic
998613691 5:143716720-143716742 ATCCCTGTGTCAGTTGTTGGTGG - Intergenic
1002779878 6:357811-357833 AAACCTATCTCACAAGATGGTGG - Intergenic
1004980634 6:21019588-21019610 ATACCTTTGTCAGAAGCCTGAGG + Intronic
1005026668 6:21468882-21468904 TTAGCTATTTCAGAACTTGGAGG + Intergenic
1010802111 6:80188391-80188413 ATACCTATCACTGAGGTTGGTGG + Intronic
1010855447 6:80832836-80832858 GTACCTATCTTAGAAGTTGCTGG - Intergenic
1011587597 6:88943451-88943473 AAACCTAAATCAGATGTTGGTGG - Intronic
1012390382 6:98731399-98731421 AAACCTCAGTCAGAAGTTGATGG - Intergenic
1012411106 6:98958196-98958218 ATACTTATGATAGCAGTTGGAGG - Intergenic
1014110199 6:117612279-117612301 AGACCTGTCTCAGAATTTGGGGG + Intergenic
1016191936 6:141279269-141279291 ATATCTATGTCAAATGTAGGTGG + Intergenic
1021242039 7:18214779-18214801 CTACCTATGACAGAATTTGCAGG - Intronic
1025962544 7:66235979-66236001 ATACCTGTCTCAGACTTTGGAGG + Intronic
1026643607 7:72149071-72149093 ATACTTATGGCAGAAGGTGAAGG - Intronic
1027596615 7:80182374-80182396 ATACCTATCTCAGAAGTGAATGG + Intronic
1027612448 7:80377908-80377930 CCACCTATCTCAGAACTTGGTGG - Intronic
1028708225 7:93875299-93875321 AGACATATCTCAGAAGATGGTGG + Intronic
1030518612 7:110568237-110568259 ATACTTCTGTCAGAAATTGATGG + Intergenic
1030832175 7:114238056-114238078 ATACATATGTCAAAAGTTTGTGG - Intronic
1031023127 7:116650012-116650034 GCACATATGTCACAAGTTGGAGG + Intergenic
1036733099 8:11283733-11283755 ATAAAAATGTCAGAAGTGGGCGG + Intergenic
1038821569 8:30956948-30956970 ATCTTTATCTCAGAAGTTGGAGG - Intergenic
1039601552 8:38842518-38842540 ATACATATGCCAGAGGTTGTGGG + Intronic
1043336860 8:79186731-79186753 TTACCTATGTCAAAATGTGGAGG - Intergenic
1046052505 8:109040377-109040399 ATTCCTATCTCAGATGTTAGTGG - Intergenic
1054789346 9:69240692-69240714 ATGCCTATGGCTGAGGTTGGAGG + Intronic
1055304212 9:74911895-74911917 ATTAATATGTCTGAAGTTGGGGG - Intergenic
1055779109 9:79800100-79800122 ATGAATATGTCAGAAGTTGGAGG + Intergenic
1056315474 9:85385452-85385474 ATGCATATGTCAGAGATTGGAGG - Intergenic
1056331799 9:85527310-85527332 ATACCTACCTCAGAAGATTGTGG - Intergenic
1058292917 9:103265526-103265548 AAACCTATCTCAGATGTTTGTGG - Intergenic
1059292701 9:113241199-113241221 GTATCAATATCAGAAGTTGGGGG + Intronic
1059665811 9:116445742-116445764 ATCCATATCTCACAAGTTGGTGG + Intronic
1060983807 9:127808566-127808588 ATACCTGTGTCCGATGCTGGAGG + Exonic
1187098565 X:16170041-16170063 CTCCCTATGTCAGAGGTTTGAGG + Intronic
1194523946 X:94953439-94953461 ATACCTATTTCTGAAGTTGAGGG + Intergenic
1195476459 X:105291652-105291674 ATATCTAGGTAAGGAGTTGGAGG - Intronic
1200297285 X:154933340-154933362 ATACCTATGTCAGAAGTTGGAGG - Intronic
1201334056 Y:12860304-12860326 TTTCCTATGTCAGAATGTGGTGG + Exonic