ID: 1200297287

View in Genome Browser
Species Human (GRCh38)
Location X:154933351-154933373
Sequence TGACATAGGTATAAGCTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297283_1200297287 -9 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297282_1200297287 7 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297281_1200297287 18 Left 1200297281 X:154933310-154933332 CCTTGGAGACACCTCAGCTGTCA 0: 1
1: 0
2: 0
3: 18
4: 212
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1200297280_1200297287 19 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297287 Original CRISPR TGACATAGGTATAAGCTATC TGG Intronic
902230866 1:15026626-15026648 TGCCATAGGGACAAGCTATCTGG - Intronic
906470222 1:46123351-46123373 TGAGATAGGAATGAGCAATCAGG + Intronic
906623650 1:47306880-47306902 TGACATAGGTGTGAGCCACCAGG - Intronic
915776221 1:158490440-158490462 TGACATATGTATCAGTAATCAGG + Intergenic
1063894786 10:10668415-10668437 AGACAGAGGAATAAGCTAACTGG - Intergenic
1069208707 10:65728590-65728612 TAACATAGCTCTAATCTATCGGG + Intergenic
1070659533 10:78294527-78294549 AGACCTAGGTATAAGAAATCAGG - Intergenic
1087806344 11:102559311-102559333 TGACATATGTCTCAGTTATCTGG - Intergenic
1091249454 11:134130038-134130060 TGACAAAGCTATGAACTATCTGG - Intronic
1093334259 12:17881711-17881733 TGACCAAGGTATAATCTAGCAGG - Intergenic
1093745225 12:22732848-22732870 TGTCATAGCTAAAAGCTATGAGG + Intergenic
1094029423 12:25993804-25993826 ATACATAGGTTTAAGCTAGCTGG - Intronic
1094081619 12:26542770-26542792 TGACATACATATAATCTATAGGG - Intronic
1095122409 12:38435100-38435122 GGTGATAGGTATAAGCTAGCAGG - Intergenic
1101836269 12:108297790-108297812 TGACAAAGGTTTGGGCTATCAGG - Intronic
1102607263 12:114077578-114077600 TGACATTGTTAGAAGTTATCAGG + Intergenic
1104278143 12:127349702-127349724 TGACATAAGTATATCCTCTCTGG - Intergenic
1108226118 13:48291436-48291458 TAACATAGGTATAAGTTTTTGGG + Intergenic
1109781161 13:67112057-67112079 TGACACAGGTATAATCTAACTGG - Intronic
1115875160 14:37853166-37853188 TTACTTAGGTATCAGCTTTCTGG + Intronic
1115878973 14:37893333-37893355 TGCCAAAGGGATAAGGTATCTGG + Intronic
1117032116 14:51683630-51683652 GGATATAAGTATTAGCTATCAGG - Intronic
1117293555 14:54357212-54357234 TCACATAGGTATAAGTTTTGTGG + Intergenic
1120066689 14:80049420-80049442 TGACATAGTTATAAGTAATCTGG - Intergenic
1126155746 15:45564176-45564198 TGACAGAGCTACAAGCTACCAGG + Intergenic
1131941961 15:97576679-97576701 AGACATTGGTATAAGCTTTGGGG - Intergenic
1138173509 16:54875101-54875123 TGAGATAAATATAAGCTAGCTGG - Intergenic
1148426360 17:47600638-47600660 TTACATAGCTTTATGCTATCAGG - Intronic
1153056823 18:953969-953991 TGAAATATGTATAAGCTAGGGGG - Intergenic
1153252987 18:3141353-3141375 TGACATAATTGTAAGATATCTGG + Intronic
1153586575 18:6627184-6627206 TGACCCAGGGAGAAGCTATCTGG - Intergenic
1159084355 18:63771497-63771519 TGAAATAAGTATAAGCTAATGGG - Intronic
1159401498 18:67942361-67942383 TAACATAGGTATAATCTGTGTGG + Intergenic
1163069944 19:14831146-14831168 TGTCATGGGTAGCAGCTATCTGG - Intronic
927732522 2:25487021-25487043 TGATATAGGTAGAAAGTATCTGG + Intronic
931269262 2:60687499-60687521 TGACAGAGGAAAAAGCTATAAGG + Intergenic
933125948 2:78606004-78606026 TGTCATTGGTATACTCTATCTGG - Intergenic
941172025 2:162150029-162150051 TGACACAGGGACAAGCAATCAGG - Intronic
942773444 2:179551039-179551061 TGACTTTTGTATAAACTATCTGG + Intronic
942847988 2:180448879-180448901 TGACCTAGGTATACATTATCAGG + Intergenic
1169468316 20:5860922-5860944 GGACATAGCTTTAAGCTTTCTGG + Intronic
1179090053 21:38256483-38256505 TGACATAGGTATAGTCTGTATGG + Intronic
950925973 3:16742359-16742381 GGACATTGGTAGAAGCTGTCTGG - Intergenic
954580129 3:51698790-51698812 TGACATAGCTCTAAACTAGCAGG + Intronic
956712460 3:72050481-72050503 TGCCTTAGCCATAAGCTATCTGG + Intergenic
958721168 3:97845602-97845624 TGACATAGGTAGAAGAGAGCAGG - Intronic
970969551 4:21965676-21965698 TGATAAAGGAATAAGCTATTTGG - Intergenic
971886829 4:32461035-32461057 TGGCATATGTATAAACTTTCAGG + Intergenic
972289934 4:37682366-37682388 TGTCATTGGTATAAACTATTAGG - Intronic
972835979 4:42870162-42870184 TGAGATGGGTATATGCTATTAGG + Intergenic
975266653 4:72377074-72377096 GGACATAGCTATATGCCATCTGG - Intronic
977053324 4:92158048-92158070 TGACCTAGGTATAAACTAGAAGG - Intergenic
978389929 4:108214903-108214925 TGAGGTCGGTATAAGCTAGCAGG - Intergenic
990444372 5:55880585-55880607 TGAAATTGGTATAACCTTTCTGG + Intronic
990979584 5:61590632-61590654 TGACATTGGCAGAAGCTAACTGG + Intergenic
993141465 5:84039053-84039075 TCACATAGGTAGTAGCTATGGGG + Intronic
993333953 5:86633958-86633980 TGAGATATGTATGGGCTATCTGG + Intergenic
1005287609 6:24345542-24345564 TGAGATAGGTATATTCTCTCAGG - Intronic
1010813462 6:80327077-80327099 TGACATAAGTATAAGCCAGCAGG + Intronic
1017694901 6:157004768-157004790 TGACATAATTATAAGCAATATGG - Intronic
1018870074 6:167775931-167775953 TGACAGAGGTAAAGTCTATCAGG - Intergenic
1027435194 7:78156959-78156981 TGACCGAGGTTTATGCTATCAGG - Intronic
1029876791 7:103762718-103762740 TGACATATGTACAAGCAATAAGG - Intronic
1031098124 7:117445135-117445157 TCACATAGGTAATAGCTATGTGG + Intergenic
1035845057 8:2853899-2853921 CGCCATAGGTCAAAGCTATCTGG - Intergenic
1038722025 8:30045749-30045771 TGAAATAGCTATAAGATAGCAGG + Intergenic
1039261039 8:35772418-35772440 TCACATAAGTATAAACTATCAGG - Intronic
1044093598 8:88033346-88033368 TGACATCCATATAAGCTATCTGG - Exonic
1046335101 8:112775109-112775131 TGACAAAGGGACAAGGTATCAGG - Intronic
1046966135 8:120167820-120167842 TGAGATAGGTGTTAGCTTTCTGG + Intronic
1047935589 8:129774794-129774816 AGACATAGAAATAAGCTAACAGG + Intronic
1053284231 9:36840063-36840085 TGCCATAGGTCTAAGATGTCCGG + Exonic
1192663268 X:73064634-73064656 TGATTTTGGTATAAGCTATAAGG - Intergenic
1200297287 X:154933351-154933373 TGACATAGGTATAAGCTATCTGG + Intronic