ID: 1200297289

View in Genome Browser
Species Human (GRCh38)
Location X:154933361-154933383
Sequence ATAAGCTATCTGGCCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200297282_1200297289 17 Left 1200297282 X:154933321-154933343 CCTCAGCTGTCAATCTCCTCCTC 0: 1
1: 0
2: 5
3: 26
4: 319
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297283_1200297289 1 Left 1200297283 X:154933337-154933359 CCTCCTCCAACTTCTGACATAGG 0: 1
1: 0
2: 0
3: 5
4: 177
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297286_1200297289 -5 Left 1200297286 X:154933343-154933365 CCAACTTCTGACATAGGTATAAG 0: 1
1: 0
2: 0
3: 9
4: 379
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297280_1200297289 29 Left 1200297280 X:154933309-154933331 CCCTTGGAGACACCTCAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297285_1200297289 -2 Left 1200297285 X:154933340-154933362 CCTCCAACTTCTGACATAGGTAT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1200297281_1200297289 28 Left 1200297281 X:154933310-154933332 CCTTGGAGACACCTCAGCTGTCA 0: 1
1: 0
2: 0
3: 18
4: 212
Right 1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG 0: 1
1: 0
2: 3
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200297289 Original CRISPR ATAAGCTATCTGGCCAAGTT GGG Intronic
901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG + Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG + Intronic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG + Intronic
911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG + Intergenic
917715303 1:177730107-177730129 ATAAACTATCTGGCTAGTTTTGG - Intergenic
920348917 1:205324749-205324771 ACCAGCTATCTGGCCATGGTCGG + Intergenic
922558837 1:226552470-226552492 ACAAACTCTCTGGCCATGTTGGG - Intronic
1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG + Intergenic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1070145285 10:73769464-73769486 ATCAACTACATGGCCAAGTTTGG + Exonic
1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG + Intronic
1074548084 10:114417348-114417370 ATAGACTTTCTGGCCAAGTGTGG - Intergenic
1074841655 10:117358830-117358852 ATAAGGCATCTGGCCCAGTGAGG + Intronic
1088514336 11:110613471-110613493 ATAAGATATATGGTCAGGTTGGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1098516129 12:71378000-71378022 AGAAGCTACCTGGCCAATTAAGG - Intronic
1099234664 12:80069252-80069274 ATAAGAAATCTGCCCAAGGTAGG - Intergenic
1100325905 12:93539719-93539741 AAAAGCTTTCTTGGCAAGTTTGG - Intergenic
1101450433 12:104772452-104772474 AAAAAATATCTGGCCAAGTGTGG - Intergenic
1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG + Intergenic
1107923603 13:45235893-45235915 ATAAAGTATCTGGCCATGTGCGG - Intronic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1110176799 13:72567039-72567061 CTCAGCTCTCTGACCAAGTTTGG + Intergenic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG + Intergenic
1128777198 15:70329513-70329535 ATAAGTTGTCTGGCCAACTTGGG - Intergenic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1130125403 15:81089679-81089701 ATAAACTATCTGGCTCAGTCTGG - Intronic
1130845328 15:87738769-87738791 ATGAGCTATCTGGACAAGTGCGG - Intergenic
1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG + Intergenic
1135209865 16:20516044-20516066 ACAAGCTCTGTGGCCAAGTATGG - Intergenic
1135376182 16:21949393-21949415 ATAAGCTATCAGGCCTGGTGCGG + Intergenic
1135611748 16:23873596-23873618 AAATGCTATCTGTCCCAGTTGGG - Intronic
1139147530 16:64342000-64342022 ATGAGAAATCTGGCCAAGTAGGG - Intergenic
1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG + Intronic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1143965957 17:10756655-10756677 AGGAGATATCTGGCCAGGTTTGG - Intergenic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG + Intergenic
1147342640 17:39763082-39763104 ATAAGCAATCTGGCATAGCTTGG + Intergenic
1148517440 17:48233562-48233584 ATAAGATTACTGGCCAAGTGTGG + Intronic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1150779309 17:68107182-68107204 ATAAGCTTTCTAGACAACTTTGG - Intergenic
1155688291 18:28582727-28582749 ATAAGCTATCTGGCCTCTATTGG - Intergenic
1159839506 18:73381956-73381978 ATAAGTTATATGGCAAAATTGGG + Intergenic
1162215694 19:9131965-9131987 AAAAGGAATCTGGCCAAGTGCGG - Intergenic
1166905701 19:46107028-46107050 ATAAGGTAACTGGGCAAGTGGGG + Intergenic
1168331625 19:55573323-55573345 ATAAGGTGTCTGGCCATGGTAGG + Intergenic
929913981 2:46118331-46118353 ACAAGCTCTTTGGCCAACTTTGG - Intronic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG + Intronic
942138598 2:172954919-172954941 ATAAGGTACCTGGCCAAAATGGG - Intronic
942650375 2:178160860-178160882 CTAAGCTATGAGGCTAAGTTTGG - Intergenic
945675772 2:212853864-212853886 ATAATTCATTTGGCCAAGTTAGG - Intergenic
945938830 2:215928166-215928188 TTCAGCAATCTGCCCAAGTTAGG + Intergenic
947380476 2:229540522-229540544 ATAGCCCATGTGGCCAAGTTGGG - Intronic
1179215742 21:39365953-39365975 ATAAGTTTAGTGGCCAAGTTTGG - Intergenic
1181538311 22:23558741-23558763 AAAAGGTATCTGGCCAGGTGTGG + Intergenic
1181935034 22:26432219-26432241 AAAAGCGATCTGCCCAAGGTTGG + Intronic
1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG + Intronic
953183698 3:40619361-40619383 AGAATCTTTCTGGCCAAGTGTGG - Intergenic
953557851 3:43960946-43960968 ACCAGCTCTCTGGCCAAGTAAGG - Intergenic
955457531 3:59140191-59140213 ATAAGCTATTTTGCCAGGATAGG + Intergenic
957682271 3:83452153-83452175 TCAACCTATCTGGCCAATTTTGG + Intergenic
959732474 3:109619648-109619670 ATAAGCTATATTGCCAAGCAAGG - Intergenic
959783182 3:110260723-110260745 TTAAGATCTCTGGCCAAGTTTGG + Intergenic
961335140 3:126171482-126171504 AGGAGCCTTCTGGCCAAGTTAGG - Intronic
965414283 3:168373115-168373137 ATAAGCTGTCTGGCCGGGTGTGG + Intergenic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
970374477 4:15442709-15442731 ATAAGCTGTCTGCCCAACCTGGG - Exonic
973148388 4:46858383-46858405 ATAAGCGATGTGGCCAAGCGTGG - Intronic
976454590 4:85231262-85231284 ATAGGCTATCAGGCCCAGCTAGG - Intergenic
976675101 4:87694340-87694362 ATAGGCAATCTGATCAAGTTAGG - Intergenic
977563748 4:98560976-98560998 ATGAGGTATGTGGCCGAGTTTGG + Intronic
977574989 4:98665821-98665843 GTGAGCTATCTGGGCAACTTGGG + Intergenic
980481503 4:133394377-133394399 ATAAGCTATATGGAAAACTTTGG - Intergenic
982578620 4:157149359-157149381 TTAAGCTATTTCGCCAAGTATGG + Intronic
988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG + Intronic
991421882 5:66450575-66450597 AAAAGCTGGCTGGCCAAGATCGG - Intergenic
995720859 5:115131040-115131062 ATAAGATATATTGCTAAGTTGGG - Intronic
997516977 5:134496867-134496889 ATAGGCTTTCTGGCCAGGTAAGG + Intergenic
1003473549 6:6460601-6460623 ATAAGCTGTCTGGTTATGTTGGG - Intergenic
1004928470 6:20438724-20438746 ATAACCAATCTGGGCAATTTGGG + Intronic
1006600672 6:35223472-35223494 ATAAACTATTTGCCCAAGCTGGG - Intronic
1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG + Intronic
1011167121 6:84461373-84461395 ATAAGCCATCTGGCCTCTTTAGG - Intergenic
1011852575 6:91648574-91648596 AAAAGATATCTGGTCAATTTTGG - Intergenic
1014041609 6:116833611-116833633 ATAAGCCAGCTGGGCAAGTACGG - Intergenic
1026216258 7:68352005-68352027 ATAAGTTATCTGGGGGAGTTTGG - Intergenic
1026556797 7:71415553-71415575 ACAAGGATTCTGGCCAAGTTTGG + Intronic
1031429255 7:121646397-121646419 TTAAAATATCTTGCCAAGTTTGG + Intergenic
1033148973 7:138896745-138896767 ATAAGCTAGCTGGGCATGGTGGG - Intronic
1037593862 8:20337421-20337443 AGAAACTATCTGGCCAGGTGTGG + Intergenic
1037671520 8:21019360-21019382 ATAAGATATTTGTGCAAGTTAGG + Intergenic
1038079476 8:24117440-24117462 AAAAGATATCCGGCCAAGTTTGG - Intergenic
1038813408 8:30875962-30875984 AAAAGCTAGCTGGGCATGTTGGG - Intronic
1042741241 8:72049561-72049583 ATAAGCAATCTGGGAAAGTTGGG - Intronic
1043445891 8:80318857-80318879 ATAATTTATCTGGCCAGGTACGG - Intergenic
1046963075 8:120130336-120130358 ATGACCTATCTGGCCAAATGTGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1186083920 X:5965375-5965397 GTAACCAATGTGGCCAAGTTGGG + Intronic
1186895544 X:14001433-14001455 ATAATCAATTTGTCCAAGTTAGG + Intergenic
1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG + Intronic
1194036618 X:88882665-88882687 ATAAGCTATTTGTAAAAGTTTGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic