ID: 1200298710

View in Genome Browser
Species Human (GRCh38)
Location X:154950058-154950080
Sequence AAGAAGAGGAAATGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 4, 2: 22, 3: 158, 4: 994}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200298710_1200298715 -1 Left 1200298710 X:154950058-154950080 CCTGGCCCACATTTCCTCTTCTT 0: 1
1: 4
2: 22
3: 158
4: 994
Right 1200298715 X:154950080-154950102 TATAAGGACACTAGTCATATTGG 0: 34
1: 374
2: 1090
3: 1951
4: 2463
1200298710_1200298717 6 Left 1200298710 X:154950058-154950080 CCTGGCCCACATTTCCTCTTCTT 0: 1
1: 4
2: 22
3: 158
4: 994
Right 1200298717 X:154950087-154950109 ACACTAGTCATATTGGATTAGGG 0: 44
1: 393
2: 1133
3: 1930
4: 2392
1200298710_1200298716 5 Left 1200298710 X:154950058-154950080 CCTGGCCCACATTTCCTCTTCTT 0: 1
1: 4
2: 22
3: 158
4: 994
Right 1200298716 X:154950086-154950108 GACACTAGTCATATTGGATTAGG 0: 34
1: 364
2: 1067
3: 1881
4: 2191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200298710 Original CRISPR AAGAAGAGGAAATGTGGGCC AGG (reversed) Intronic
900332551 1:2143322-2143344 AAGACGAGGAAATATAGGCCGGG - Intronic
900711426 1:4117015-4117037 ATAAAGGGGAAATGTAGGCCAGG - Intergenic
900992608 1:6104813-6104835 AAGGAGGGGAAATGTCAGCCAGG + Exonic
901106573 1:6760913-6760935 AAGAAAAGGAAAAAGGGGCCGGG + Intergenic
901416728 1:9121690-9121712 AAAAAGGGGAAACCTGGGCCTGG - Intronic
901553890 1:10016569-10016591 AAAAAGAGGAACTGCTGGCCAGG - Intergenic
901691308 1:10974974-10974996 AAGAAGATGAAATGAGGGCTGGG + Intronic
901692784 1:10984453-10984475 AAGAAGAGGAAAATTGGGGCCGG - Intergenic
901801409 1:11710194-11710216 AAAAAAAAGAAATGTGGGGCGGG + Intronic
901977923 1:13010116-13010138 AAAAATAGAAAAAGTGGGCCAGG - Intronic
902004163 1:13218821-13218843 AAAAATAGAAAAAGTGGGCCAGG + Intergenic
902023386 1:13364562-13364584 AAAAATAGAAAAAGTGGGCCAGG + Intergenic
902302209 1:15510223-15510245 AAAAAGAAAAAATGTAGGCCGGG - Intronic
902369810 1:15998894-15998916 AAGAAAAAAAAATGTGGGCCAGG + Intergenic
903007375 1:20307611-20307633 CAGCAGAGGAAATGTGGGAGTGG - Intronic
903053475 1:20618763-20618785 AAGGAAAGGAAAGGTGGGGCAGG - Exonic
903517527 1:23921903-23921925 AAGCAGAGGGAACATGGGCCAGG - Intergenic
903696899 1:25214419-25214441 AAGAAAAAAAAATTTGGGCCGGG + Intergenic
904036550 1:27562102-27562124 AAGCAGAGGCAGGGTGGGCCGGG + Intronic
904154845 1:28474222-28474244 ATAAAAAGAAAATGTGGGCCGGG + Intronic
904234252 1:29103960-29103982 AATAAAAAGCAATGTGGGCCGGG - Intronic
904263465 1:29304534-29304556 GAAAAGAGGAAAAGAGGGCCAGG - Intronic
904690256 1:32288528-32288550 AAGATAGGGAAATGTTGGCCAGG + Intergenic
905014526 1:34768221-34768243 AAGAAGTGGGACTCTGGGCCGGG + Intronic
905164798 1:36073735-36073757 GAGAAGATAAAATCTGGGCCAGG - Intergenic
905188497 1:36214561-36214583 TAAAAAAGGAAATGTGGGCCAGG + Intergenic
905192892 1:36249485-36249507 AAGAATAGGGACTGTGGGGCTGG - Intronic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
905619818 1:39434616-39434638 AACAAGAGGAAATGAGGGTAAGG + Exonic
906357694 1:45121244-45121266 ATTAAGACGAAAGGTGGGCCGGG - Intronic
906368587 1:45232989-45233011 ATGAAAAGCTAATGTGGGCCGGG - Intronic
906395264 1:45457683-45457705 AGGAGAAGGAAATGTGAGCCAGG - Exonic
906913811 1:49985189-49985211 TACAAGAGGGAATGTGGGGCAGG - Intronic
907112273 1:51936789-51936811 AAGAAAAGAAAATGTGTGCTAGG - Intronic
907155255 1:52327676-52327698 AAGAAAAGGGAAGGTAGGCCGGG + Intronic
907740148 1:57157603-57157625 AAGAAGAGGAAAGGAGGCCAGGG - Intronic
907758209 1:57331738-57331760 AAGAAGAGCAATTGTGGGAAGGG - Intronic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908244963 1:62220602-62220624 AAGAATATGAAAAGTAGGCCGGG + Intergenic
908458030 1:64323148-64323170 GAGAACAGGAAATTGGGGCCTGG + Intergenic
908505899 1:64799734-64799756 AAGAAAAGGAAATCACGGCCAGG - Intronic
908526265 1:64990624-64990646 AATAAAAGAAAATATGGGCCAGG + Intergenic
908661688 1:66444013-66444035 AAGAAGAGCAAACTTGAGCCTGG - Intergenic
908897771 1:68919729-68919751 AAGAATATGAAAGATGGGCCTGG - Intergenic
909129209 1:71714150-71714172 AAGGAGAGAGAATGAGGGCCAGG + Intronic
910116424 1:83736960-83736982 AAAAAGAGAAAATTTGGGCCAGG + Intergenic
910232482 1:85000173-85000195 AAGAAAAGAAAATGTGAGTCAGG + Intronic
910524010 1:88156618-88156640 AAGAACAGTAAGTGTGAGCCTGG - Intergenic
910829923 1:91450114-91450136 ATGCACAGGAAATGTTGGCCTGG + Intergenic
912488754 1:110049553-110049575 AAGAACAGGTGATGAGGGCCAGG + Exonic
912502359 1:110130627-110130649 AAGATGAGGAAATGGGGGTGGGG + Intergenic
912823283 1:112884226-112884248 AAGAAAAAGAAAAGCGGGCCAGG + Intergenic
913303123 1:117394375-117394397 AAAAAGAGAAAATGAAGGCCAGG - Intronic
914232993 1:145781819-145781841 AGGAAGAGTTAAGGTGGGCCAGG - Intronic
914508244 1:148307842-148307864 CACAAGAGGCAGTGTGGGCCAGG + Intergenic
914769531 1:150671509-150671531 AAAAAGAGGAAAGAAGGGCCGGG + Intronic
914830425 1:151166898-151166920 GAGAAGAGGATAAGTGGTCCAGG - Intronic
914936638 1:151987293-151987315 AAAAAGAGGAACACTGGGCCGGG - Intronic
915024663 1:152816501-152816523 ATTAAGAAGAAATGGGGGCCTGG + Intergenic
915329448 1:155100993-155101015 AATAAAAAGAAATATGGGCCGGG - Intergenic
915464326 1:156087534-156087556 AAGAAAAGAAAATGGGAGCCGGG - Intronic
916290749 1:163163874-163163896 AACCAGAGGAAAAGTGGGGCAGG - Intronic
916362192 1:163983040-163983062 ACGAGGAGGAAATGTGGGCAGGG + Intergenic
916693326 1:167212007-167212029 AAGAAGAGGGAAAGTGAGACTGG + Intergenic
917469366 1:175313613-175313635 AAAAAGAGGAAATGCGGCACAGG + Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917630378 1:176885586-176885608 AAGCAGAGAAAAGGAGGGCCAGG - Intronic
917968253 1:180191988-180192010 AGGAAGAGGAAATTTGGACATGG - Intronic
918191990 1:182184694-182184716 AAGAAAAGAAAATGGGGGCCAGG + Intergenic
918450165 1:184650103-184650125 CAGAGGAGGAAATGAGGGGCTGG - Intergenic
918506740 1:185263080-185263102 AAGAAGAGAAAATTTGGGGCTGG - Intronic
919636849 1:200011604-200011626 AATAATAGCAAATGTTGGCCAGG - Intergenic
919647152 1:200106350-200106372 AAGAAGAGTGAATCTAGGCCGGG - Intronic
919810528 1:201406229-201406251 CAGATGAGGAAATGGAGGCCTGG - Exonic
919998657 1:202777792-202777814 AAGAAAAGTTAAGGTGGGCCAGG - Intronic
920212657 1:204339487-204339509 AAGAAGAGGAATTGTGTGCTGGG + Intronic
920446925 1:206024704-206024726 AAGAAGAGGAAATGTGGATGTGG - Intergenic
920454676 1:206090500-206090522 TTGAAGAGGAATTGTGGGCCAGG - Intronic
920525392 1:206662369-206662391 AAGAAGTGGGAATGTGAGACGGG + Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
920623699 1:207575373-207575395 ATTAAGAAGCAATGTGGGCCAGG + Intronic
920751053 1:208677497-208677519 AAGAAGAGGACATGTAGGGCTGG - Intergenic
920780614 1:208987563-208987585 AAATAAAGGAAATGTGGGCCGGG - Intergenic
921169608 1:212534873-212534895 AAGAAAAGAAAATATGGGCTGGG - Intergenic
921310009 1:213833269-213833291 AAGAAGTGCTACTGTGGGCCAGG + Intergenic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
922080742 1:222293472-222293494 GAGAAGTGGAAATGTGGCACTGG - Intergenic
922346305 1:224699579-224699601 AAGAAGAGGAAATTAGGACACGG - Intronic
922707635 1:227797707-227797729 TAAAAGGGTAAATGTGGGCCGGG + Intergenic
922881645 1:228985644-228985666 AAGAAGAGGAGATGAGGACACGG - Intergenic
923129489 1:231063060-231063082 AAGAGGAGGAAATTTGAACCTGG + Intergenic
923353769 1:233133558-233133580 TATAAGAGGAAATTGGGGCCAGG + Intronic
923362077 1:233221670-233221692 CAGGAGAGGTAATGAGGGCCTGG + Intronic
923411469 1:233714149-233714171 GAGAAGTGGGAATGTGGTCCTGG - Intergenic
923441512 1:234024964-234024986 AAGAAGAGGGAGGGTGGGACAGG - Intronic
923986325 1:239386769-239386791 AAGAAGAGAAAAAGTGAGGCGGG + Intronic
924513682 1:244749111-244749133 AAGAAGAGGGGATTAGGGCCAGG + Intergenic
924736733 1:246763891-246763913 AAGTAATGGAAATATGGGCCTGG - Intronic
1063426920 10:5957567-5957589 AAGAAAAGAAAAAGTTGGCCAGG - Intronic
1063813751 10:9746149-9746171 AAAAAAAGTAAATGTAGGCCAGG + Intergenic
1064005114 10:11693199-11693221 AAGAAGAGGAAATGTTTGCTGGG - Intergenic
1064606870 10:17051064-17051086 AAAGAGAGAAAATATGGGCCAGG + Intronic
1064676381 10:17764391-17764413 AAGAAAAGGATACGTGGGCATGG - Intronic
1065437820 10:25719845-25719867 ATGAAGAAGAAATTTGGGCTTGG - Intergenic
1065480578 10:26189768-26189790 AAGAAAGGAAAATCTGGGCCAGG + Intronic
1065591991 10:27272155-27272177 AAGAAAAGGAAAACTGGGGCCGG - Intergenic
1065766576 10:29035878-29035900 AACAAAAGAAAATGTGTGCCTGG - Intergenic
1065914341 10:30340621-30340643 AAGAAAAGGAACACTGGGCCGGG + Intronic
1065919885 10:30383969-30383991 TAGAAAAGAAAATGTAGGCCTGG + Intergenic
1066632760 10:37472742-37472764 AAGAATAGAATAAGTGGGCCGGG + Intergenic
1067358512 10:45554622-45554644 AAGAAGAGACAATGTGGACCAGG + Intronic
1067437937 10:46292031-46292053 AACAAAAGGAGATGTGGGTCAGG - Intronic
1067715378 10:48686183-48686205 AAGAAAAGAAAATTTCGGCCAGG + Intronic
1068033547 10:51732218-51732240 AAGAAAAGGAAATTTGGGCCAGG - Intronic
1069069978 10:63983164-63983186 AAGAAGTTGTATTGTGGGCCGGG + Intergenic
1069548709 10:69347305-69347327 GAAAAGAGGAAATGTGTGGCCGG - Intronic
1070530761 10:77335267-77335289 AAGAAGAGGCAGTGTGGAACAGG - Intronic
1070968068 10:80541881-80541903 AAGGAGAGGAGATGAGGGCACGG + Intronic
1071116959 10:82233007-82233029 AGGTAGAGGAAATGTGGCTCTGG + Intronic
1071350639 10:84739360-84739382 AATAAGAGAATATATGGGCCGGG - Intergenic
1072069559 10:91903416-91903438 AAGAATATAAAATGTTGGCCTGG - Intergenic
1072129775 10:92483073-92483095 AAGAAAAGGAGAGGTTGGCCGGG - Intronic
1072160745 10:92764024-92764046 CAGAAGAGTATATGTGGTCCTGG + Intergenic
1072693595 10:97587289-97587311 CTGAAGAGGAGATGAGGGCCAGG + Intronic
1072711500 10:97718530-97718552 CAGAAGAGGAAATGAAGTCCAGG + Intergenic
1073108970 10:101049583-101049605 CATTAGAAGAAATGTGGGCCGGG + Intergenic
1073261602 10:102194807-102194829 AAAAAATGGAAAGGTGGGCCAGG - Intergenic
1073352771 10:102831623-102831645 TGGAAGAGGAAAAGTGGGTCTGG + Intronic
1073666117 10:105535643-105535665 AAGAAAAGCAAATGTGTGACAGG - Intergenic
1074187992 10:111113570-111113592 AGGAAGAGGAAAAGAGGGCTGGG + Intergenic
1074216549 10:111390368-111390390 GAGATGAGGAAATGTTGCCCAGG + Intergenic
1074329768 10:112494489-112494511 AGGAAGAGGAAAGGAGGGCAGGG - Intronic
1074567963 10:114598289-114598311 AAAAAAAGGAAATGTGCGGCCGG + Intronic
1075011065 10:118870585-118870607 AAGATGGGGCAATGTGGGGCTGG - Intergenic
1075085249 10:119410376-119410398 TAGCAAAGGAAATGTGGGTCAGG + Intronic
1075086000 10:119414784-119414806 AAGAAAAGGCAATGATGGCCGGG + Intronic
1075128325 10:119719033-119719055 AAGAAAAGAAAATTTAGGCCAGG - Intergenic
1075235851 10:120728026-120728048 AAAAAGGGGAAATGTAGGCCAGG - Intergenic
1075308016 10:121384941-121384963 AAAAAGGGGAAATTTGGGGCCGG - Intergenic
1075494754 10:122910346-122910368 AAGAAAAAGAAATGTGGGAAGGG - Intergenic
1075998691 10:126898003-126898025 AAGCAGAGGAAATTTAGGGCTGG - Intergenic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076107433 10:127834685-127834707 AGGAGGAGGAACTGTGAGCCGGG - Intergenic
1076741964 10:132490123-132490145 TGGAAGAGGAAATGTGGAGCTGG + Intergenic
1077301724 11:1850353-1850375 AAAAAGAGGAAATGTGGACACGG - Intergenic
1077301772 11:1850674-1850696 AAAAAGAGGAAATGTGAGCCAGG - Intergenic
1077379362 11:2221761-2221783 AATAAGTGGAAATCTGGCCCAGG + Intergenic
1077672044 11:4166220-4166242 GAGGAGAGGACATTTGGGCCAGG + Intergenic
1077999485 11:7482178-7482200 ACAAAGAGGAAATTTGGACCAGG - Intergenic
1078217119 11:9320850-9320872 AAGAATAGAAAATGTTGGCTGGG - Intergenic
1078229719 11:9429217-9429239 AAGAAAAGTGAATGTTGGCCAGG + Intronic
1078296843 11:10079950-10079972 AAGAAAAAAAAATGTGGGACAGG + Intronic
1078785037 11:14482085-14482107 GTAAAGAGCAAATGTGGGCCAGG - Intronic
1078794947 11:14583143-14583165 AAGAAGAGGAAATTAGGACAGGG - Intronic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1079235840 11:18689577-18689599 AAAAAGAGCCTATGTGGGCCGGG + Intergenic
1080438445 11:32268204-32268226 AGGAAGAGGAAAGGTGGGTGGGG + Intergenic
1081013381 11:37844282-37844304 AAAAAATGGAAATGTCGGCCGGG - Intergenic
1081615769 11:44590311-44590333 AAAAATATGAAATCTGGGCCGGG + Intronic
1081700258 11:45148009-45148031 CCCAAGAGGAAATGTGGGCAAGG - Intronic
1082205322 11:49426643-49426665 AAGAAGAGGAAATTTGAGCATGG + Intergenic
1082759672 11:57115211-57115233 CAGAAGAGGAATTCAGGGCCAGG - Intergenic
1083481774 11:62953045-62953067 AATAAAAAGAAATGGGGGCCGGG - Intronic
1083740728 11:64710201-64710223 AAGAAAAAGAAACGTGAGCCAGG - Intronic
1083907270 11:65681234-65681256 AAAAAAAAAAAATGTGGGCCGGG - Intergenic
1084654756 11:70508595-70508617 GAAAAGGGGAAATTTGGGCCAGG + Intronic
1084731512 11:71076651-71076673 AAGAAGGGGCCATGGGGGCCGGG - Intronic
1084745367 11:71166776-71166798 AAAAAAAAGAAGTGTGGGCCCGG - Intronic
1084749082 11:71192154-71192176 AAGAAGATGAGATGAAGGCCGGG - Intronic
1084863200 11:72035703-72035725 TAAAAGGGTAAATGTGGGCCGGG - Intronic
1084930206 11:72549273-72549295 AAGAAATGGACATCTGGGCCAGG - Intergenic
1085226306 11:74924178-74924200 AAAAAGAGTAAGAGTGGGCCGGG + Intronic
1085487222 11:76875409-76875431 AAAAAAATGAAATGTTGGCCGGG - Intronic
1085624603 11:78062286-78062308 AAGAAAAGAAAATGAAGGCCTGG - Intronic
1085911740 11:80834907-80834929 AAGAATAGGAAAAATAGGCCAGG - Intergenic
1085950616 11:81327029-81327051 AAAAATATGATATGTGGGCCTGG + Intergenic
1086433771 11:86761781-86761803 AAGAAGTGAAAATTTGGGCAAGG - Intergenic
1086526794 11:87737445-87737467 AATAAAAGAAAATGAGGGCCGGG - Intergenic
1086649782 11:89273891-89273913 AAGAAGAGGAAATTTGAGCATGG - Intronic
1087362319 11:97176597-97176619 AAAAAGAGGAAATTTGGACACGG - Intergenic
1087528093 11:99344088-99344110 AAGTTGAGGAGATGTGGGGCTGG - Intronic
1087589268 11:100165085-100165107 AGGAAGAGGAGATGAGGGTCAGG + Intronic
1088316026 11:108507860-108507882 AATTAAAGAAAATGTGGGCCAGG + Exonic
1088363074 11:109011442-109011464 AAGAAGAAGAAATTTGGACATGG + Intergenic
1088610719 11:111573591-111573613 AGGAAGACAAATTGTGGGCCAGG - Intergenic
1088886184 11:114008870-114008892 AAAAAAAAAAAATGTGGGCCAGG - Intergenic
1089424825 11:118363911-118363933 AACAAAAGCTAATGTGGGCCAGG - Intronic
1089554016 11:119304918-119304940 AAGAATACGAAGTATGGGCCGGG - Exonic
1089603556 11:119628948-119628970 CAGGAGAAGAAATGTGGACCAGG - Intronic
1090654139 11:128829832-128829854 AGGAAGAGGAAATGTGTCCAAGG - Intergenic
1091068006 11:132535426-132535448 AGGCAGAAGAAAAGTGGGCCTGG + Intronic
1091191698 11:133701109-133701131 CTGATGAGGAAATGTGAGCCTGG - Intergenic
1091517683 12:1200851-1200873 AAGAAAAGGAAATGTGGGCCGGG - Intronic
1091549182 12:1524867-1524889 ATAAAGAGAAAATGGGGGCCGGG - Intergenic
1091698337 12:2643040-2643062 AGGAAGAGCAAAAGAGGGCCAGG + Intronic
1092060695 12:5548100-5548122 GGGAAGAGGAAATGTGGGGCTGG - Intronic
1092078292 12:5691606-5691628 AAGAAGAGTGAATGCAGGCCAGG + Intronic
1092383513 12:8018159-8018181 AAGAAGAGTTAATCTGAGCCGGG - Intergenic
1092651990 12:10645022-10645044 AGGAAGAGGAATTGGGGTCCAGG + Intronic
1092742599 12:11644621-11644643 AAAAAAAGAAAATATGGGCCAGG + Intergenic
1092829817 12:12433036-12433058 AAAATGAGGAAATCTGGGCTGGG + Intronic
1093457710 12:19380969-19380991 AAGAAGAGCTCATGTGGGGCCGG + Intergenic
1093830054 12:23744964-23744986 AAGAAGAGGAAATTTGGACATGG - Intronic
1094553598 12:31475826-31475848 TAAAAGAGGAGGTGTGGGCCGGG + Intronic
1094747495 12:33362463-33362485 AAAAAGAGAAAAAATGGGCCGGG - Intergenic
1094814287 12:34168099-34168121 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1095102637 12:38200490-38200512 AAGAAGAACAAAAATGGGCCAGG + Intergenic
1095713094 12:45311121-45311143 AAAATGAAGAAATGTGTGCCTGG + Intronic
1095829018 12:46562940-46562962 TAGAAGAGGAAAAGTAGGCATGG + Intergenic
1096013702 12:48246770-48246792 AAGAAGATGAAATGGTGGCGGGG + Intergenic
1096349845 12:50888259-50888281 AACAAAAGAAAATGAGGGCCAGG + Intergenic
1096469718 12:51868681-51868703 AGGAAGAGGGAGTGTGGGCTGGG - Intergenic
1096655630 12:53089687-53089709 AAAAAGGGGAAATTTGGGCCGGG + Intergenic
1098381886 12:69878751-69878773 TAGATGAGGAAATGGAGGCCTGG + Intronic
1098726111 12:73969838-73969860 AAGAAGAGGGAAAGTGGGTGAGG + Intergenic
1099276943 12:80588775-80588797 ATGAAGGAAAAATGTGGGCCTGG - Intronic
1099347104 12:81515684-81515706 AAAAAGAGAAAATGTGGGGGAGG - Intronic
1099400643 12:82199217-82199239 AAAAATAGGAAATGTTGGCAAGG + Intergenic
1100013075 12:89976932-89976954 ATGAGTAGGAAATGTGGCCCTGG + Intergenic
1100072209 12:90734866-90734888 ACAAAGAGGAAATGTGGGGTTGG - Intergenic
1100313598 12:93421451-93421473 AAGATTAGGAAACATGGGCCGGG - Intronic
1100446938 12:94669513-94669535 AATAATAGAAAATGTGGGCTGGG - Intergenic
1100558030 12:95717103-95717125 AAAAAGTGGAAAAGAGGGCCAGG - Intronic
1100928731 12:99581593-99581615 AAGAAAATGAAAAGTCGGCCGGG + Intronic
1100933031 12:99632376-99632398 AAAAAGTGGAAATGTGGGGTTGG + Intronic
1100949953 12:99836749-99836771 GAGAAGAGAAAATATGGGCTGGG - Intronic
1100963414 12:99987532-99987554 AATAATAGCAAATGTAGGCCGGG + Intergenic
1101002692 12:100372508-100372530 AAGAAGAGGACATTTGAGCCAGG - Intronic
1101139746 12:101783006-101783028 CAGCAGAGGAAGTGTCGGCCAGG - Intronic
1101494671 12:105242384-105242406 AAGATGAGGAAATTGAGGCCTGG + Intronic
1102088442 12:110163908-110163930 AAGAAGTGAAAATTTGGGGCCGG - Intronic
1102149588 12:110679556-110679578 CAAAAGAGGAAAACTGGGCCGGG + Intronic
1102371991 12:112389492-112389514 AAAAAGAGAAAATTTGGGCCAGG - Intergenic
1102410351 12:112712248-112712270 AAGAATAGAAAATGTTGGTCTGG - Intronic
1102905939 12:116675364-116675386 AAGTAGATGGAGTGTGGGCCGGG - Intergenic
1103652618 12:122444613-122444635 AAGAAAAAGAAATGGGGGCTGGG - Intergenic
1103703242 12:122858722-122858744 AGGAAGAGGAAAGGAGGGCTCGG - Intronic
1103963757 12:124625221-124625243 AAGAAGAGGAGATTAGGGCATGG - Intergenic
1104499334 12:129269641-129269663 ACGAAGAGGAAAGATGAGCCTGG + Intronic
1104520086 12:129465976-129465998 AAAATGAGGAAATGAGGGCCAGG - Intronic
1104960904 12:132488413-132488435 AAGGCCAGGAAATGTGGGCGAGG - Intergenic
1105517124 13:21100859-21100881 AAGAAGGGGATATTTGGGCCGGG + Intergenic
1106029768 13:25989619-25989641 AAGAAAAGGAAATGTCAGCCAGG - Intronic
1106217843 13:27719258-27719280 AAGAAGAAGAAAGGAGGGGCAGG + Intergenic
1106270654 13:28150328-28150350 AAAAAGATTTAATGTGGGCCAGG + Intronic
1106369887 13:29121953-29121975 TAGAAGTGAAAAAGTGGGCCGGG - Intronic
1106684574 13:32044617-32044639 GAGCAGAGGAAAAGTGGGGCGGG - Intronic
1107149183 13:37091847-37091869 AAGAACAGGAGATGAGGGCTGGG - Intergenic
1107326569 13:39249969-39249991 AAGAAAATGAAATGGGGGTCGGG + Intergenic
1107469534 13:40679305-40679327 GAGAAGAGGGAATGTGGCACAGG - Intergenic
1107484246 13:40811193-40811215 AAGAAAAGCAATTGTAGGCCAGG + Intergenic
1107500095 13:40964828-40964850 AAAAAGGGGAAATTTGGGCTGGG - Intronic
1107766003 13:43735422-43735444 GAAAAAGGGAAATGTGGGCCAGG + Intronic
1108202546 13:48057644-48057666 AAGAAGAGGGAATGGAGGGCGGG - Intronic
1109023404 13:57129320-57129342 AAAAAGAACAAATTTGGGCCGGG + Intergenic
1109302670 13:60605265-60605287 AAGAAGTAGGAAAGTGGGCCAGG + Intergenic
1110605525 13:77427563-77427585 AAGAAGAGGAGAATAGGGCCGGG - Intergenic
1110640024 13:77813047-77813069 AAGAAGAGGAAATGAGAACATGG - Intergenic
1110702559 13:78566139-78566161 AAGAAGAGGAAATTCAGGCTGGG + Intergenic
1111250017 13:85590098-85590120 AAAAAGAGGACAGGTCGGCCGGG - Intergenic
1111284202 13:86066819-86066841 AAGCAGAGTAAATCTGGGTCTGG + Intergenic
1111427827 13:88111898-88111920 AAGAGGAGCAAAAGTGGGCAAGG - Intergenic
1111779407 13:92702624-92702646 CAGAAGAGAAAATGGGGGCTTGG - Intronic
1111948581 13:94691575-94691597 ACATAGAGGAAATGTGGGCTTGG - Intergenic
1112346338 13:98593171-98593193 AAAAAAAAAAAATGTGGGCCTGG - Intergenic
1112488215 13:99838932-99838954 AAGAATGTGAAATGTAGGCCAGG - Intronic
1112646373 13:101337601-101337623 AAAAAGAATAAATGTGGGCTGGG - Intronic
1112800356 13:103103320-103103342 AAAAAAAGGAAATCTGGGCCGGG + Intergenic
1112928383 13:104705366-104705388 AAGAAGATGAAGTATGGACCTGG - Intergenic
1113261379 13:108567475-108567497 AACATGAGGAAATGTGGGAGTGG + Intergenic
1113432477 13:110262619-110262641 AAGAAGAGGAAGCATGGCCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114288542 14:21269178-21269200 AAGCAGAATAAATGAGGGCCCGG + Intronic
1114600377 14:23951563-23951585 AAGAACAGGAAATCTTGGGCTGG - Intergenic
1115492692 14:33973388-33973410 AAGACGAGAAATTGAGGGCCGGG - Intronic
1115753472 14:36513142-36513164 GATAAGAGGAAATGAGAGCCGGG - Exonic
1116351665 14:43871352-43871374 AAGGAGAGGAAATGGTGGGCAGG - Intergenic
1116891476 14:50272876-50272898 AAGAAGAAAAAATATAGGCCAGG + Intronic
1117488645 14:56224845-56224867 AGGAAGAGGGTATGGGGGCCAGG - Intronic
1117575828 14:57096244-57096266 AAGAAAAGGAACTGGGGGCAGGG - Intergenic
1118051305 14:62031514-62031536 AAGAGGGGCAAATGTGAGCCTGG + Intronic
1118174496 14:63424454-63424476 AAGAAGAGAAAGGGTCGGCCGGG + Intronic
1118202302 14:63687624-63687646 AGGCAGAGGAAATGTGTACCAGG + Intronic
1118454517 14:65932298-65932320 AATAGAAGGAAATGTGGGCCGGG + Intergenic
1118547393 14:66906562-66906584 ATGAAGATGAGATGTGGCCCTGG - Intronic
1119122135 14:72089595-72089617 AAGACCAGGAAATGAGGACCAGG - Intronic
1119155477 14:72406089-72406111 CAAAAGAGGAAATAAGGGCCAGG + Intronic
1119490544 14:75028851-75028873 GAGAAAAGAAAATGTTGGCCAGG + Intronic
1119738619 14:76999671-76999693 AAGAATAGGAATGGTGGGGCGGG + Intergenic
1119774904 14:77242309-77242331 AAGAGGAAGAAATGTGGGTCTGG - Intronic
1119811855 14:77528218-77528240 AAGAAGAGGAAAAGAGGGGTGGG - Intronic
1120520963 14:85528163-85528185 ACGAATAGGAAATGTGGCTCAGG - Intergenic
1120779895 14:88477763-88477785 GAGGAGTGGAGATGTGGGCCAGG + Intronic
1120887451 14:89462977-89462999 AAGAAGAGGAAGAGAGGGCTGGG - Intronic
1121024117 14:90601868-90601890 CAGATGAGGAAATGAGGCCCAGG + Intronic
1121053565 14:90835510-90835532 TAAAAGAGTAAATTTGGGCCAGG - Intergenic
1121584112 14:95051216-95051238 ATGAAGGGGAAATGAGAGCCTGG - Intergenic
1121678200 14:95771480-95771502 GAGCAGAGGAAATTTGGGTCAGG + Intergenic
1122115783 14:99526592-99526614 AGGAAGAGGAAGTGGGGGCAAGG + Intronic
1122190713 14:100040810-100040832 AAGAATAATAAATGTGGGCATGG + Intronic
1122426953 14:101615757-101615779 AAGAAAAGAAAATGAGGGCCAGG + Intergenic
1122704238 14:103609984-103610006 TAAAAGGGGAAATGTGGGCCGGG + Intronic
1122835278 14:104427700-104427722 AGGAGGAGGAAATTGGGGCCTGG - Intergenic
1122907729 14:104809856-104809878 AAGAAGAGGAGATTAGGGCCAGG - Intergenic
1123759353 15:23420798-23420820 AACAAAAGGTAATGGGGGCCAGG - Intergenic
1123844668 15:24286424-24286446 AAGAAGAAAAAATGTTGGCATGG - Intergenic
1124178707 15:27452686-27452708 AAGAAGAGGAAGGGTTGGTCTGG + Intronic
1124352241 15:28964781-28964803 AAAATGAGCAAAAGTGGGCCAGG - Intronic
1124508224 15:30297501-30297523 AAAATAAGGAAATCTGGGCCAGG - Intergenic
1124735331 15:32241155-32241177 AAAATAAGGAAATCTGGGCCAGG + Intergenic
1125034844 15:35111695-35111717 AAAAAGAGAGAATGGGGGCCGGG + Intergenic
1125202385 15:37111369-37111391 AAGAGGAAGAAATGTGGGGAAGG - Intergenic
1125460278 15:39899804-39899826 AAGATAAGGAAATATGGGCTGGG + Intronic
1125529428 15:40402628-40402650 CTTAAGAGGTAATGTGGGCCAGG - Intergenic
1125663066 15:41409337-41409359 AAAAAGAAAAAATGTGGGCCGGG - Intronic
1125668074 15:41448369-41448391 AAAAATGGGAAATGTTGGCCGGG + Intronic
1125770483 15:42162258-42162280 GAGAAGAGGAAATGTGGAAAGGG - Intronic
1125823469 15:42654984-42655006 AAAAAGAACAAATCTGGGCCAGG + Intronic
1125933878 15:43618213-43618235 AGGAAGAAGAAATGTTGGCCAGG + Exonic
1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG + Intergenic
1125994272 15:44142792-44142814 AAGAAGAGTAAACGTAGGCCGGG + Intronic
1126185112 15:45823942-45823964 CAGAAGAGGAACCCTGGGCCTGG + Intergenic
1126194547 15:45917670-45917692 GAGAAGAGGAGCTGGGGGCCTGG + Intergenic
1126378723 15:48023688-48023710 AAGAAGACGAAATGTGAACTAGG + Intergenic
1126485962 15:49181100-49181122 AAGAAGAGGAGATGAGGGGAGGG - Intronic
1126633365 15:50759197-50759219 AAAAATAGGAAAAGTTGGCCAGG - Intronic
1127139157 15:55956107-55956129 AAAAAAAAGAAATGTGGGCTGGG - Intronic
1127516694 15:59701135-59701157 AAGAAGAGGCAGTCTTGGCCAGG - Intergenic
1127759790 15:62127716-62127738 AAGAATAGGAAAGTTGGGGCCGG + Intergenic
1127877870 15:63126435-63126457 AATAAAAGTAAGTGTGGGCCGGG - Intronic
1128181516 15:65609645-65609667 GAGAAGAGGAAATGTGTTTCTGG - Intronic
1128352351 15:66899626-66899648 AAGAAAAAGAAATGGAGGCCAGG - Intergenic
1128367549 15:67015145-67015167 AAAAAGTGGAGATTTGGGCCGGG - Intergenic
1128972318 15:72118279-72118301 AAGAAGAAAAAATTTGGGCGGGG - Exonic
1129187054 15:73914672-73914694 AAGAAAAGGAAATGTGGATAAGG - Intergenic
1129201356 15:74003136-74003158 AAAAAGAAAAAAAGTGGGCCAGG + Intronic
1129237563 15:74232949-74232971 GAGAAGAGGGCAAGTGGGCCTGG - Intergenic
1130217398 15:81985323-81985345 AAGAACAGCATATGTTGGCCGGG + Intergenic
1130293176 15:82622688-82622710 ATGAAGAAGAGATGTGGGCTGGG - Intronic
1130311839 15:82763129-82763151 AACAAGTGGAAATGTGAGTCTGG - Intronic
1130337743 15:82971925-82971947 TAGAAGAGGAGATTTAGGCCTGG - Intronic
1130434549 15:83884568-83884590 ATTAAAAGGAAATGGGGGCCAGG - Intronic
1130524117 15:84689072-84689094 AAGAAAAGAAACTGGGGGCCAGG + Intronic
1130585557 15:85178268-85178290 TAGAAAAGGAAATGTAGGCCTGG - Intergenic
1130610981 15:85360687-85360709 TAGAAAAGCAAATCTGGGCCGGG - Intergenic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131614592 15:94001791-94001813 AGGAAGTGGAAATATGTGCCTGG - Intergenic
1131651514 15:94404592-94404614 AAGAAGATGAAACGGAGGCCAGG - Intronic
1131879392 15:96846421-96846443 AAAAATAGGAAATGTTGGCAGGG - Intergenic
1132175653 15:99711917-99711939 CAGATGAGGAAATGAGGGGCTGG - Intronic
1132179793 15:99743662-99743684 AAGAAGAGGAAATTTGGATCAGG + Intergenic
1132405968 15:101542074-101542096 AAGATGAGGACTTGTGGGCCGGG + Intergenic
1133061290 16:3175997-3176019 AAGAAGAGGAAATTCAGGGCAGG - Intergenic
1133326526 16:4945390-4945412 AAGAAAAAGGAATGTGGCCCAGG - Intronic
1133466651 16:6034037-6034059 AAGAATAGGAATCGTTGGCCAGG + Intronic
1133504159 16:6393930-6393952 AAGAAGAAGAAAAGTGGGAGAGG + Intronic
1133562504 16:6963072-6963094 AAGGAGAGGGAAGGTGGGCCTGG - Intronic
1133812082 16:9168411-9168433 AAAAAAGGGAAATTTGGGCCAGG + Intergenic
1133835864 16:9366653-9366675 GAGACAAGGAAATGTGGTCCTGG + Intergenic
1133981980 16:10639837-10639859 CAGAAGGGGACAGGTGGGCCTGG - Intronic
1134455717 16:14393886-14393908 AAGAAGTGGACATGTGGGCTGGG - Intergenic
1134456993 16:14402060-14402082 AACAAAAGGTAATGGGGGCCAGG + Intergenic
1134594161 16:15482198-15482220 GAGAAGAGGAAAGGAGAGCCAGG + Intronic
1134724905 16:16411550-16411572 AAAAAAATGAAATTTGGGCCAGG + Intergenic
1134832629 16:17336059-17336081 AAGAAGAGGAAAGGTGTCCCAGG + Intronic
1134836300 16:17363972-17363994 AAGAAAAGGAAATTTGAGCCAGG - Intronic
1134942527 16:18300309-18300331 AAAAAAATGAAATTTGGGCCAGG - Intergenic
1135080430 16:19429853-19429875 AAAAAGGGGAACTTTGGGCCAGG - Intronic
1135263184 16:20998908-20998930 AAGATGAGGAACTGAGGGTCAGG + Intronic
1135549505 16:23387440-23387462 AAAAAGAAAAAATGTGGGCCAGG + Intergenic
1135612993 16:23884834-23884856 AAGAAAAGGAGATATGGGCTAGG - Intronic
1135704254 16:24661034-24661056 AAGAAGAAGAAAGCTGGGCAGGG - Intergenic
1136133770 16:28241679-28241701 AAGAAGAGGAGATTAGGGCTGGG - Intergenic
1136511652 16:30741562-30741584 CAGGAGAGGAAATGTGTGGCTGG - Intronic
1137397252 16:48124928-48124950 AAGCAAATGAAATGTGGGGCAGG + Intronic
1137630371 16:49939107-49939129 AAGAAAAGTAATTGGGGGCCGGG + Intergenic
1138224743 16:55282922-55282944 AAGAAGAAGAAAAGTGGACGGGG + Intergenic
1138268733 16:55679557-55679579 AAGAAGAGGAAAGGGTGGCAGGG - Intronic
1138647759 16:58437641-58437663 AAGAAGAGGTCATGTTGGCCAGG + Intergenic
1138648434 16:58442543-58442565 AACAGGAGGAAAACTGGGCCAGG + Intergenic
1139285401 16:65809011-65809033 AAGAAGAGGAAATTTGGACACGG + Intergenic
1139451711 16:67032834-67032856 AAGAAGAGGACAACTGGGGCAGG - Intronic
1139760587 16:69181542-69181564 AAAAAAAGGAAATGGCGGCCAGG - Intronic
1140104415 16:71946702-71946724 AAGAAGTGGATTTGTGGGGCAGG + Intronic
1140685078 16:77425745-77425767 AAAAAGAGGAGGAGTGGGCCGGG + Intronic
1140708008 16:77648991-77649013 AAAAAGAGCTAAGGTGGGCCAGG - Intergenic
1140837819 16:78811664-78811686 AAGAAGAGGACAAGGGGGCTGGG - Intronic
1140877745 16:79168706-79168728 AAGAGGAGGAAAGCTGGGCAAGG + Intronic
1140921621 16:79543656-79543678 AAGAAAAAGAAAAGAGGGCCTGG - Intergenic
1141065400 16:80909797-80909819 AAGATGAGGAAAGGTAGGCGAGG + Intergenic
1141128598 16:81418869-81418891 AAATAAAGAAAATGTGGGCCTGG - Intergenic
1141818762 16:86430929-86430951 AAGATGTGGAAATGAGAGCCTGG - Intergenic
1142273690 16:89104595-89104617 AAGCAGAGGGAAGGTGGGCAGGG - Intronic
1142350740 16:89578356-89578378 AAAAAGAGGAAAAGTGGGCTGGG - Intronic
1142587059 17:980133-980155 GAGGAGAGAAAATGCGGGCCGGG - Intergenic
1142642398 17:1291913-1291935 TAAAACAGGAAATGTAGGCCAGG + Intronic
1142703522 17:1679276-1679298 AAGAAGAGGTAAGGTGCCCCAGG - Exonic
1142919472 17:3171753-3171775 AAGGAGAGGAAATGGGGGATTGG + Intergenic
1143097376 17:4485689-4485711 AAGAAGATGAACTCTGGGCCAGG - Intronic
1143113376 17:4566527-4566549 AAGAAAAGAAAATCTGGGCCAGG - Intergenic
1143134789 17:4706041-4706063 AATAAGAGGAAAAACGGGCCAGG - Intergenic
1143271012 17:5674403-5674425 AAAAAGAGGAAATGAATGCCTGG - Intergenic
1143310597 17:5985387-5985409 AAGAAGAGGAAATTTGGGCCGGG + Intronic
1143350952 17:6288035-6288057 TATAAGAGGAAGTATGGGCCAGG - Intergenic
1143505984 17:7365599-7365621 CAGAACAGGAAGGGTGGGCCGGG + Intergenic
1143514576 17:7413418-7413440 AAGAGGAGGGCCTGTGGGCCAGG + Intronic
1143745978 17:8994455-8994477 AACAAGAGGAAATCAGGGCAGGG + Intergenic
1143846455 17:9775903-9775925 AAGAAGAGGAAATTTGGGGCCGG + Intronic
1144144156 17:12381007-12381029 AAGATAAGGAGTTGTGGGCCGGG - Intergenic
1144354241 17:14428883-14428905 AAGAAGAGGAAGTGAGGGGGAGG - Intergenic
1144463847 17:15480845-15480867 CAAAAGAGGAAAAGTTGGCCGGG + Intronic
1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG + Intronic
1144588538 17:16504115-16504137 AAACAGAGGAAATGTGGGGTGGG - Intergenic
1144654052 17:17024409-17024431 AAAAAGGGGAAATTTGGGTCCGG - Intergenic
1144763598 17:17721209-17721231 AAGAAGAGAAAACTTGGGCTTGG + Intronic
1145054926 17:19696155-19696177 TAAAAGAGGGAATTTGGGCCTGG + Intronic
1145075536 17:19851727-19851749 AAGAAGAGGGCATCTCGGCCGGG + Intronic
1145297209 17:21601229-21601251 CAGGAGAGGACATGTGGGTCGGG - Intergenic
1145366741 17:22271671-22271693 CAGGAGAGGACATGTGGGTCGGG + Intergenic
1145748087 17:27334939-27334961 AAGAAAAGAAAATGTTGGCCAGG - Intergenic
1146303509 17:31710377-31710399 AAGATGAGAAAATATTGGCCAGG + Intergenic
1146800526 17:35816120-35816142 AAGAATAGTAAATGAAGGCCAGG - Intronic
1146888998 17:36492772-36492794 AAATGGAGGTAATGTGGGCCTGG + Intronic
1147206219 17:38839491-38839513 AAGAAAAGAAAAATTGGGCCGGG + Intronic
1147229167 17:39004612-39004634 AGGAGGAAGAAATGGGGGCCAGG - Intergenic
1147465757 17:40609409-40609431 AGGAAGAGGAGATCGGGGCCGGG - Intergenic
1147693161 17:42330722-42330744 GAAAAGAGAAAATGTGGGCCGGG - Intronic
1147980454 17:44270873-44270895 AACAAGAGTAAATGTGGGCCAGG - Intergenic
1148492390 17:48031780-48031802 AAGAGCAGGACATGTGGGGCTGG + Intronic
1148520226 17:48266803-48266825 AAGAAAAGGAAAACAGGGCCGGG - Intronic
1149248822 17:54744287-54744309 TAGAAGAGGAGATCAGGGCCAGG + Intergenic
1149524880 17:57347675-57347697 AAGAAGTGGAAATTTTGTCCTGG + Intronic
1149744751 17:59085533-59085555 AAAAAGAGCAAGTGTTGGCCAGG + Intronic
1149758162 17:59205404-59205426 TAGAAAAGTAAATGTTGGCCGGG + Intronic
1149758311 17:59206741-59206763 TAGAAAAGTAAATGTTGGCCGGG + Intronic
1150076224 17:62194313-62194335 AAGAATAGGGATTGTGGGCCAGG - Intergenic
1150117131 17:62562822-62562844 AACAAAAGCAAATGTTGGCCGGG + Intronic
1150181232 17:63123260-63123282 TAAGAGGGGAAATGTGGGCCAGG + Intronic
1150221704 17:63499288-63499310 AAAAATAGGAAACGGGGGCCAGG - Intronic
1150431559 17:65122550-65122572 AAGATGAGGAACTATGAGCCTGG - Intergenic
1150434962 17:65146597-65146619 AAGAAAAGAAAATCTTGGCCGGG + Intronic
1150691791 17:67373421-67373443 AAAAAGAGGCCATGTTGGCCGGG + Intergenic
1150920947 17:69481704-69481726 ATGAAGAGGAAATTTGGACATGG - Intronic
1151249296 17:72821205-72821227 AAAAAGGGGAAATCTGGGCCAGG + Intronic
1151331551 17:73412618-73412640 AAGAAGAGGACATTTAGGCCAGG + Intronic
1151454564 17:74218231-74218253 AAGAAGAGGGAAGGTGGGCAAGG - Intronic
1151643724 17:75415292-75415314 AAGAAGAAGAGATTGGGGCCGGG + Intergenic
1151871134 17:76837714-76837736 AAAAAGAGGAAATTCAGGCCAGG + Intergenic
1152321997 17:79612906-79612928 AGGGAGAAGAAATGTGGGCAAGG - Intergenic
1152764921 17:82131133-82131155 AAGAAAAATAAATGTAGGCCAGG + Intronic
1152957396 18:50703-50725 AAGAAGAACAAAAATGGGCCAGG - Intronic
1153050104 18:893964-893986 AAAAAGGGGAAATTTGGGCTGGG - Intergenic
1153170688 18:2312502-2312524 AAGAAGAGGAGGAGTGGGGCAGG + Intergenic
1153237151 18:2999299-2999321 AAAAAGAGGAAATCTGGTCCAGG + Intronic
1153339154 18:3956641-3956663 AAGAAAAGGAAAAATAGGCCGGG - Intronic
1153643749 18:7176469-7176491 CAGAACGAGAAATGTGGGCCGGG - Intergenic
1154065164 18:11100888-11100910 TAAAAGTGAAAATGTGGGCCAGG - Intronic
1154134566 18:11764400-11764422 AAGAACAGGATATTTGGGCCAGG - Intronic
1155608326 18:27633576-27633598 AAGAAGGGGAAAGGTGAGGCTGG - Intergenic
1155626984 18:27845799-27845821 AAGAATAGAAAATGTTGGCTGGG - Intergenic
1155688795 18:28590314-28590336 AAAAATAGGTAATGTAGGCCGGG - Intergenic
1155999949 18:32373488-32373510 AGGAAGAGAAAATGTAGGTCTGG - Intronic
1156100806 18:33592713-33592735 AACAAAAGTAAAGGTGGGCCTGG - Intronic
1156487917 18:37478308-37478330 AAGCAGAGGGAACCTGGGCCAGG - Intronic
1157130993 18:45007171-45007193 AGGAAGAGATATTGTGGGCCAGG - Intronic
1157243745 18:46035457-46035479 AAGAAGAGGAAAATTTGACCTGG + Intronic
1157526595 18:48387650-48387672 AAGAAGAGGAAATATGAGCCTGG + Intronic
1157537090 18:48467857-48467879 AAAAAGGGGAAATCTGGGCCAGG + Intergenic
1157667976 18:49503988-49504010 AAGTATAGGAAATGAGGGCCTGG - Intergenic
1157903070 18:51539562-51539584 AAGAAGATGAAATGTCAGCTGGG - Intergenic
1158032018 18:52977588-52977610 AAGAAAAGCATATCTGGGCCGGG + Intronic
1158510945 18:58090131-58090153 AAGAAAAGGAAGTTTGGGCTGGG - Intronic
1158633204 18:59133947-59133969 AAGAAGAGGAAGCTTGAGCCAGG + Intergenic
1158696517 18:59708839-59708861 AAGAAGAAGGAAGGTGGGCCGGG - Intergenic
1159760045 18:72414203-72414225 AAGATGAGGCAATGTGGGAATGG + Intergenic
1160434491 18:78836072-78836094 AAGGAGAGGAAATATGGGGGAGG + Intergenic
1160527630 18:79546806-79546828 AAACAGAAGACATGTGGGCCCGG - Intergenic
1160922282 19:1526625-1526647 AGGAAGGGGAACTGTGGGCGGGG + Intronic
1161071738 19:2265727-2265749 TAAAAGAGGGTATGTGGGCCCGG - Intronic
1161330024 19:3682383-3682405 AAAAAAAGGCATTGTGGGCCAGG + Intronic
1161385957 19:3993051-3993073 CAGAATAAGAAATGTTGGCCAGG - Intergenic
1161392067 19:4026425-4026447 AAGAAAAAGAAATGTGGGATGGG - Intronic
1161803837 19:6430781-6430803 AAGAAAAGGAAAAGAAGGCCAGG - Intronic
1162297408 19:9822792-9822814 GAGAAGAGGAAAATGGGGCCGGG - Intronic
1162432860 19:10639581-10639603 AAGAAGTGGAGATAAGGGCCAGG + Intronic
1162844918 19:13384891-13384913 AAGAACTGGAAATGTGAGCCTGG + Intronic
1162855448 19:13464841-13464863 AAAAATAGGAAAAGTTGGCCGGG - Intronic
1163295255 19:16407619-16407641 AAGAAGGGGAAAAGAAGGCCAGG - Intronic
1163352956 19:16790893-16790915 AAAAAAAGGAGAGGTGGGCCAGG - Intronic
1163373373 19:16914905-16914927 TAGATGAGGAAATGGAGGCCGGG - Intronic
1163480272 19:17551388-17551410 AAAAAAAAGAAATGTAGGCCGGG - Intronic
1163600377 19:18245645-18245667 AAAAAGAGAAAATGTGGGGTTGG - Intronic
1163670744 19:18626964-18626986 AAGAAGAGAAACTGGGGGCCAGG - Intergenic
1163715657 19:18870668-18870690 AAGAAGCGGGAAAGAGGGCCAGG - Intronic
1164146609 19:22516629-22516651 AGGAAGTGGAAATGGGGGCCTGG - Intronic
1164229795 19:23277120-23277142 TAGAGGAAGAAAAGTGGGCCCGG + Intergenic
1164826033 19:31285485-31285507 AAAAAAAGGAAAAGTAGGCCAGG + Intronic
1165144566 19:33723062-33723084 AGGGAGTGGAAATGTGAGCCAGG - Intronic
1165503616 19:36210123-36210145 AAAAAAAGGAAATGGAGGCCAGG + Intronic
1165573311 19:36793416-36793438 AAAAAGAGTAACTTTGGGCCGGG + Intergenic
1166319649 19:42008929-42008951 AAGATGAGGGAATTTGGGCCAGG + Intronic
1166387578 19:42390719-42390741 AAGAAGAGGGGAGATGGGCCAGG + Intergenic
1166395334 19:42435535-42435557 AAGAAAAGGAGATTTGGGCTGGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166642800 19:44508683-44508705 AAAAAGAAGAAAACTGGGCCAGG - Intronic
1166680424 19:44762813-44762835 AAAATGAAGAAATTTGGGCCTGG - Intergenic
1166967824 19:46540892-46540914 AAGAAGAGGAAATTTAGGCCGGG - Intronic
1167265890 19:48482977-48482999 AGGAGGAGGAGATGGGGGCCTGG - Intergenic
1167356223 19:49005963-49005985 AAGAAGAGGAAAGGCGAGGCCGG - Intronic
1167416713 19:49377338-49377360 AATAAAAGCCAATGTGGGCCGGG - Intergenic
1167591149 19:50405204-50405226 ACAAAGAGGACATGTGGGCTAGG - Intronic
1167620755 19:50559137-50559159 AAGAAAAAGAAAAGAGGGCCGGG + Intronic
1167691940 19:50990836-50990858 AAGCAGAGGAAATGTGTGTGGGG + Intergenic
1167841609 19:52126230-52126252 ATTAAAAAGAAATGTGGGCCGGG + Intronic
1167995978 19:53402553-53402575 AACAAGAGAAAATATAGGCCGGG - Intronic
1168167899 19:54565567-54565589 AAGAATAGTAATTATGGGCCAGG - Intergenic
1168190929 19:54738693-54738715 TAGAAGTGGAGATCTGGGCCTGG + Intronic
1168193171 19:54755208-54755230 TAGAAGTGGAGATCTGGGCCTGG + Intronic
1168201160 19:54817013-54817035 ATGAAGTGGAGATCTGGGCCTGG + Intronic
1168221315 19:54962565-54962587 AAGAAAAGAAAATGAGGGGCCGG - Intronic
1168499759 19:56883691-56883713 TATAAAAGGCAATGTGGGCCAGG - Intergenic
925114649 2:1368365-1368387 TTGAAAAGAAAATGTGGGCCAGG + Intergenic
925916735 2:8612325-8612347 AAAAAGAGGAAATTAAGGCCAGG + Intergenic
926025688 2:9542242-9542264 AAGAATATTAAATTTGGGCCAGG + Intronic
926037483 2:9646752-9646774 AAGAAGAGGAAGGGAGGGCTTGG + Intergenic
926046486 2:9713708-9713730 AAGAAGTGTAAATATAGGCCGGG + Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
926624455 2:15079485-15079507 AGGAGGAGGAAAGGTGGCCCTGG - Intergenic
926640357 2:15229484-15229506 TAAAAGAGGACATGTGGGCCTGG + Intronic
926870967 2:17416748-17416770 AAGAAAAGGAAATTTGGACATGG - Intergenic
927828081 2:26323599-26323621 AAGAAGAAGTAATGGAGGCCAGG - Intronic
927830219 2:26343736-26343758 AAAAAGAGGGTATTTGGGCCGGG - Intronic
928318390 2:30263818-30263840 AAGAAAAAGAAATGTTGGCTGGG + Intronic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929546196 2:42856565-42856587 AAACAGAGGAAATGGGAGCCAGG - Intergenic
929574754 2:43044400-43044422 AAGAAGAGGAAAGAGAGGCCAGG + Intergenic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
929912261 2:46100232-46100254 AATGACAGGAATTGTGGGCCTGG - Intronic
930889499 2:56366847-56366869 AAGAAGGAGAAATCTGGACCAGG - Intronic
931169785 2:59790680-59790702 AAGAAGAAGAAAAGAGGGACAGG + Intergenic
931366631 2:61624878-61624900 AAGAGGAGGCAATGTGCTCCTGG + Intergenic
931390875 2:61842836-61842858 AAATAGAGGAAATGGGGGCAGGG + Intronic
931513198 2:63022608-63022630 AAGAACTGGCAATGTTGGCCAGG - Intronic
931597433 2:63964690-63964712 GAGAAGAAGAAATGTGGGGAAGG - Intronic
931609920 2:64087960-64087982 CAGATGAGGAAATGAAGGCCAGG - Intergenic
931750783 2:65328015-65328037 AAGAAAAGCAAAAATGGGCCGGG - Intronic
932141613 2:69283482-69283504 AAAAAGAGGAAATTTAGGCTGGG + Intergenic
932328965 2:70886698-70886720 AAGAAGAGGCAATGGGAGCCGGG - Intergenic
932576793 2:72966795-72966817 AAGAGGAAGCACTGTGGGCCTGG - Intronic
932612563 2:73210664-73210686 AGGAAGAGCAAATATTGGCCAGG + Intronic
932646452 2:73508184-73508206 AAGAAGAAGAAAGGAGGGCAGGG - Intronic
932739803 2:74282858-74282880 GAGAGGAGGAAATCTGGGCAGGG - Intronic
932800517 2:74738590-74738612 AAAAAGAGGACATATTGGCCGGG + Intergenic
932807964 2:74799164-74799186 AAGAATAAAAGATGTGGGCCAGG + Intergenic
932825504 2:74935320-74935342 AAGAAGAGGTCATGTGAGCATGG + Intergenic
933209718 2:79552521-79552543 ACAGAGAGGAAATGTGGGGCTGG - Intronic
933242354 2:79936444-79936466 AAGAGGAGGAAAAGGGGGTCGGG - Intronic
933533940 2:83547985-83548007 TAAATGAGTAAATGTGGGCCAGG + Intergenic
933616487 2:84487111-84487133 AAAAAGAGTAAATGTGGTCTGGG + Intergenic
933657972 2:84905152-84905174 AAGGAGAGGAAAAGTGGGGGAGG + Intronic
933663515 2:84946274-84946296 TATAAGAAGTAATGTGGGCCTGG - Intergenic
933690481 2:85175742-85175764 AGGAAGAGGGACTGTAGGCCTGG + Intronic
933760777 2:85670566-85670588 AAGAAGGAAACATGTGGGCCAGG - Intergenic
934636099 2:95991497-95991519 AAGGAAAGGTAATGGGGGCCGGG - Exonic
934797547 2:97113929-97113951 AAGGAAAGGTAATGGGGGCCGGG + Exonic
934835865 2:97589510-97589532 AAGGAAAGGTAATGGGGGCCGGG - Exonic
935029059 2:99304571-99304593 AAGAAGAGGACATAAGTGCCTGG + Intronic
935244301 2:101204991-101205013 CAGAGTAGGAAATGTGGACCAGG + Intronic
935391947 2:102562129-102562151 AAGAAGCAGAAATGTGAGCTTGG + Intergenic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935609500 2:105006308-105006330 AAGAAGAGGAGATTAGGGCACGG - Intergenic
935660613 2:105463773-105463795 AAAGAAAGGAAATGTGGGCCGGG + Intergenic
935997460 2:108789295-108789317 TAGAAAAGGAACTATGGGCCAGG + Intronic
936081091 2:109432821-109432843 CAGAAGGTGAAATGTGGGCCTGG - Intronic
936230293 2:110694619-110694641 AGGAAGAGGAAAAGTGGGAGTGG + Intergenic
936690495 2:114882505-114882527 AAGAAGAAGAAAGGTGGGAAGGG + Intronic
936896997 2:117439050-117439072 AAAAAGGGTACATGTGGGCCAGG + Intergenic
937014059 2:118587468-118587490 AAGAAGAGGAAATCTGGACACGG + Intergenic
937290378 2:120778281-120778303 AAGAGGAGGAGGAGTGGGCCAGG - Intronic
937305272 2:120867085-120867107 AAGAAGGGGAAATTGAGGCCCGG - Intronic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
937952064 2:127396159-127396181 GAGTAAAGAAAATGTGGGCCGGG + Intergenic
938375989 2:130807114-130807136 AAGAAATGGTAATCTGGGCCGGG - Intergenic
938476876 2:131624078-131624100 AAGAAAATGAATTCTGGGCCGGG + Intergenic
939021294 2:136961107-136961129 AAAAAGAGAAAATGTGAGACTGG + Intronic
940793399 2:158051927-158051949 CAGCAGAGGATATGTGTGCCAGG - Intronic
941171325 2:162140840-162140862 AAGAAGAAGAAATGTAGGCAAGG - Intergenic
941254503 2:163211663-163211685 AAGAAGAGGAAATCTGGACATGG - Intergenic
941465052 2:165815638-165815660 AACAAGAGAAAAGCTGGGCCTGG - Intergenic
941635872 2:167934434-167934456 AAAAAGGGTAAATTTGGGCCGGG + Intergenic
941924130 2:170879227-170879249 AAGAAGGGGACATTTTGGCCAGG - Intergenic
942486070 2:176441064-176441086 AAAAAGAGGAAATTTGGGCCAGG - Intergenic
944397263 2:199282174-199282196 AAGAAGAGAGAATATGGGCCGGG - Intronic
944546353 2:200802733-200802755 AAGAAGTGGAATTGCCGGCCAGG - Intergenic
944779702 2:203005546-203005568 AAAAAGAGTAAAACTGGGCCGGG + Intronic
945243655 2:207698864-207698886 AAGAAGAGGAAGTTTGTGCCAGG - Intergenic
945312640 2:208332937-208332959 TAGAAAAGAAAATGTTGGCCGGG + Intronic
945730028 2:213522181-213522203 AATAGGAGGAGATGGGGGCCTGG + Intronic
945742913 2:213685306-213685328 AAGAAGGAGAAAGGTGGGCATGG + Intronic
945878358 2:215301882-215301904 AATAACATTAAATGTGGGCCAGG + Intergenic
945905917 2:215593318-215593340 AAGTAGAGGACAGGGGGGCCAGG + Intergenic
946156293 2:217808914-217808936 AGGAATAGGAAATGTGGGGAGGG + Intronic
946241068 2:218356385-218356407 AAGAATATCAAATGTGGGCCAGG + Intergenic
946354083 2:219173989-219174011 AAGAAGAGGACAGATGGGTCTGG + Intronic
946581076 2:221128732-221128754 AAGAACACGAAATGTGGGAGAGG + Intergenic
946591001 2:221246811-221246833 AAGAATAGAAAATGTAGGCTGGG + Intergenic
946614734 2:221497271-221497293 CAGATGAGGAAATTGGGGCCTGG + Intronic
946658884 2:221978334-221978356 AAGAAGAGAAAATGGACGCCAGG - Intergenic
946663111 2:222021608-222021630 CAAAAAGGGAAATGTGGGCCTGG + Intergenic
946806713 2:223477738-223477760 AAGTAGAGGGAATGTAGGCTAGG + Intergenic
947958698 2:234216535-234216557 AAGAAGAAGAAGTGTGAGACTGG - Intergenic
948431416 2:237921546-237921568 AAGAAGAGAAGATTAGGGCCAGG - Intergenic
948967437 2:241394221-241394243 TAAAAGTGGACATGTGGGCCAGG + Intronic
1168763862 20:368577-368599 AAGAAGATGAAGAATGGGCCGGG - Intronic
1168897343 20:1332800-1332822 AAGAAGAGAGAATGTCGGCTGGG + Intronic
1169011541 20:2255312-2255334 AAGAAGAGGAAACTGAGGCCTGG + Intergenic
1169261895 20:4145325-4145347 AAGAAGAGGAGATTTGAGCTGGG + Intronic
1169563980 20:6832823-6832845 AAAATAAGGAGATGTGGGCCAGG + Intergenic
1169947501 20:11004890-11004912 AAGAAAAGAAAATGTTAGCCTGG - Intergenic
1171249834 20:23638640-23638662 AAGAAGAGGATAGGAGGGACAGG - Intergenic
1171775483 20:29363476-29363498 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1171817501 20:29801281-29801303 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1171900843 20:30854816-30854838 AAGAAGAATAAAAATGGGCCAGG + Intergenic
1172116461 20:32576216-32576238 AAGAAGGGGTTATGTGGGCAGGG + Intronic
1172144372 20:32745811-32745833 AAGAAGACAAAAGTTGGGCCAGG - Intergenic
1172599155 20:36171721-36171743 ATGAAAAGGAAGTGTGGGGCGGG + Intronic
1172650944 20:36500913-36500935 CAGATGAGGAAATGGGGGCTCGG - Intronic
1172719283 20:36986970-36986992 AAAAACAGCAAAAGTGGGCCGGG + Intergenic
1172828972 20:37815611-37815633 TAGAAGAGCCAATGTGGGCCAGG - Intronic
1172920212 20:38474572-38474594 AAGAAAAGGGTATGTAGGCCTGG - Intronic
1172926579 20:38542568-38542590 AAGAAGACCATGTGTGGGCCAGG + Intronic
1172954068 20:38742961-38742983 AAGAAGAGGAAAAGTGGGCTGGG + Intergenic
1172984720 20:38975250-38975272 CAGCAGAGGAAATGGTGGCCTGG + Intronic
1173058184 20:39636318-39636340 AAGGAGAGGGGATGTGGGGCAGG - Intergenic
1173320000 20:41978894-41978916 AAGATGGGGAAATGTAGGCCTGG + Intergenic
1173606208 20:44333674-44333696 ATGGAGAGGATATGAGGGCCTGG + Intergenic
1173985326 20:47257025-47257047 TAGAAGAGAAGAGGTGGGCCCGG - Intronic
1174001269 20:47376554-47376576 AAGAAGAAGAAATCTAGGCTAGG + Intergenic
1174055140 20:47793477-47793499 AAGAAGAGAAAGTGGGGGCCAGG + Intergenic
1174198435 20:48789947-48789969 AAGAAGGAGAAAAATGGGCCTGG + Intronic
1174217077 20:48924212-48924234 AAGAAGAGAAATTTGGGGCCAGG + Intronic
1174396343 20:50249071-50249093 AAGAAAAGGAAATGTGGGTCAGG + Intergenic
1174510530 20:51048109-51048131 AAGAATAGTACAGGTGGGCCGGG - Intergenic
1174600364 20:51719437-51719459 AAAAAGAAGAAACATGGGCCAGG + Intronic
1174635780 20:51998300-51998322 AAGAAGAGGAGGTGGAGGCCGGG - Intergenic
1174796059 20:53523426-53523448 AAAAAGATGAAAACTGGGCCGGG + Intergenic
1174838583 20:53880660-53880682 AATAAGCCAAAATGTGGGCCTGG + Intergenic
1175106836 20:56621336-56621358 AAGGAAAGGAAATGTTGGCCTGG + Intergenic
1175200562 20:57274136-57274158 AAACAGAGGAAATCTTGGCCAGG - Intergenic
1175242010 20:57556673-57556695 AAGAACAGAAATTCTGGGCCGGG - Intergenic
1175648199 20:60693945-60693967 AAGAAGAGGGAATGTGGAGGAGG + Intergenic
1175921317 20:62451734-62451756 AAGAAGAGGGAAAGTGGGGAGGG + Intergenic
1176302073 21:5103160-5103182 AAAAAAAGGAAATGTGGGCCGGG + Intergenic
1176361984 21:6005696-6005718 ATGAAGAGGCAATGGAGGCCAGG - Intergenic
1176363348 21:6016915-6016937 AAGAAGAGGGAGAGTTGGCCGGG + Intergenic
1177207055 21:18022310-18022332 AAGAGGAGGCAATGTGGCCATGG - Intronic
1177238070 21:18419518-18419540 AAAAAGAGGAAATGTCGGCCGGG - Intronic
1177605346 21:23370666-23370688 AAAAAGAATAAATATGGGCCAGG + Intergenic
1178096109 21:29217450-29217472 AATAAGAGGACGTGTGGGCCGGG + Intronic
1178172535 21:30057865-30057887 ATGAAAAGAAAAAGTGGGCCAGG + Intergenic
1178273477 21:31215293-31215315 AAGAAGAAGAGAAATGGGCCAGG + Intronic
1178355155 21:31905156-31905178 AAGAAGAGGAAATTTGGACACGG + Intronic
1178365982 21:31989115-31989137 AAAATGTGGAAATTTGGGCCAGG - Intronic
1178846099 21:36175404-36175426 AAGAAGAGGAAATCTGGGCCAGG - Intronic
1179066598 21:38030295-38030317 TAGAAGACAAAATGTGGGCGGGG + Intronic
1179388652 21:40967135-40967157 TAGAACAGGAGAAGTGGGCCAGG + Intergenic
1179760170 21:43521630-43521652 AAGAAGAGGGAGAGTTGGCCGGG - Intergenic
1179761534 21:43532849-43532871 ATGAAGAGGCAATGGAGGCCAGG + Intronic
1179854956 21:44158740-44158762 AAAAAAAGGAAATGTGGGCCGGG - Intergenic
1180055251 21:45355395-45355417 AAGAAGAGCAGATGAGGGCACGG + Intergenic
1180167032 21:46035695-46035717 AAAAACAGGAACTGTCGGCCCGG + Intergenic
1180334213 22:11560803-11560825 AAGAAGAATAAAAATGGGCCAGG + Intergenic
1180840645 22:18957413-18957435 AAGGAAAGGAAATGGGGGCTGGG + Intergenic
1180863514 22:19101750-19101772 AAAAAAAGTGAATGTGGGCCAGG + Intronic
1181005439 22:20011236-20011258 AAGGAGAGGGAATGTGTCCCCGG - Intronic
1181014017 22:20058012-20058034 AAAAAAAGGCAATGTGGACCAGG - Intronic
1181060843 22:20281361-20281383 AAGGAAAGGAAATGGGGGCTGGG - Intronic
1181325827 22:22045197-22045219 ATATAAAGGAAATGTGGGCCGGG + Intergenic
1181632263 22:24157367-24157389 CAGAAGGGGCAATCTGGGCCAGG + Intronic
1181952342 22:26563622-26563644 AAGAAGAGGGAGGGAGGGCCGGG - Intronic
1182208074 22:28648611-28648633 GAAAAAAGAAAATGTGGGCCAGG + Intronic
1182227751 22:28812690-28812712 AATAAGAGGATATTTTGGCCAGG - Intergenic
1182305116 22:29362638-29362660 AAGAATGGGAAATCTGGGCCAGG - Intronic
1182312426 22:29418791-29418813 AAGAATGGGAAATCTGGGCCAGG - Intronic
1182578693 22:31291094-31291116 GAGAGAAGGAAATGTGTGCCGGG + Intronic
1182670120 22:31988708-31988730 TATAAGAGGAAATGTGGGCCAGG + Intergenic
1182687267 22:32130889-32130911 AAGAAAAGGAAGAATGGGCCGGG + Intergenic
1182687835 22:32134473-32134495 AAGAATGGGAAATCTGGGCCAGG + Intergenic
1182783375 22:32885854-32885876 TAGAAAAGGGAATATGGGCCTGG - Intronic
1182806515 22:33075420-33075442 AAGCAGAGGAAATGAGGCCCAGG - Intergenic
1183143797 22:35970673-35970695 AAGAAGAAGAAATGTGATCATGG + Intronic
1183405235 22:37627297-37627319 AGGAAAAGGAAATGAGGACCCGG + Intronic
1183552595 22:38499867-38499889 AAGAAGAGACAATGTTGGCTGGG + Intronic
1183890061 22:40920070-40920092 TAGAAATGGACATGTGGGCCAGG + Intronic
1183908791 22:41063015-41063037 AAAAAGATTAAATGTAGGCCGGG + Intergenic
1184104016 22:42357089-42357111 GAGAAGAGGAAGGGTGGGCCAGG + Intergenic
1184261424 22:43319252-43319274 AAGAAGAGAAGATTAGGGCCAGG + Intronic
1184797385 22:46739941-46739963 AAGAAGAGGAAATGTTGACCGGG + Intergenic
1184801983 22:46766829-46766851 AAAAACAGGAGGTGTGGGCCGGG - Intronic
1185165070 22:49256529-49256551 AAGAAGAGGATAAATGGGCCAGG + Intergenic
949959142 3:9297598-9297620 AAAAAGAGAAAATTAGGGCCAGG + Intronic
949979747 3:9494654-9494676 AAGAAGGGGAAATGAGTGACTGG - Intergenic
950031614 3:9857494-9857516 AAGAAAAGAAAATCTAGGCCGGG + Intergenic
950248193 3:11440976-11440998 AATAAAAGCAAATGGGGGCCAGG - Intronic
950656163 3:14438138-14438160 AAAAAAAGAAAAAGTGGGCCAGG - Intronic
951267633 3:20588243-20588265 AAGAAGAGGAAATTTGAGGCCGG - Intergenic
951634421 3:24757256-24757278 TAGAAGAGGAGATTTGGGCCAGG + Intergenic
951864029 3:27286683-27286705 AAGAACTGGAAATGGCGGCCGGG - Intronic
952050263 3:29376473-29376495 AAAAAGACACAATGTGGGCCGGG + Intronic
952247369 3:31608819-31608841 AAGAAAAGGATGTGTTGGCCAGG + Intronic
952262861 3:31757301-31757323 AAAAAGGGGAAATTTGGGCCAGG + Intronic
952724582 3:36570123-36570145 AAGAAGGGGAGAGGTGGGCATGG - Intergenic
952747381 3:36794066-36794088 ATGAAGAAGACATGTGGGCCGGG - Intergenic
952859322 3:37799740-37799762 GAGAAGACGAGATGTGAGCCAGG + Intronic
953858217 3:46518070-46518092 TAGTTGAGGAAGTGTGGGCCTGG - Exonic
954002357 3:47567621-47567643 CAGAACAGGAAATTTTGGCCTGG - Intronic
954010131 3:47629082-47629104 AGGAACTGGAAATGTGTGCCTGG + Intronic
954165684 3:48755765-48755787 AAAAAAAGGAAATGGGGGCTGGG - Intronic
954865426 3:53725077-53725099 TAGAAGAGGAAATTTGTGGCTGG - Intronic
954997703 3:54896689-54896711 CAGCAGAGTAAAGGTGGGCCTGG - Intronic
955897940 3:63720732-63720754 AAGAAGAGGAAAGGTGGGACAGG + Intergenic
955920071 3:63946342-63946364 AAAAGAAGGAATTGTGGGCCAGG + Intronic
956663190 3:71619127-71619149 AAGGAGGAGGAATGTGGGCCTGG - Intergenic
956735059 3:72231929-72231951 AAGATGAGGAAATGACGCCCAGG - Intergenic
957205475 3:77192947-77192969 TAAAAATGGAAATGTGGGCCGGG - Intronic
957475655 3:80720010-80720032 AAGAAGAAGAAATGTGTGCTAGG + Intergenic
957490605 3:80921792-80921814 ATGAAGAGGAAATGTGGGATTGG + Intergenic
957528732 3:81412560-81412582 AAAAAGAAAAAATCTGGGCCGGG - Intergenic
957559522 3:81803975-81803997 AGGAAGAGTTAATGCGGGCCTGG - Intergenic
957875947 3:86147002-86147024 ATGAAGTGGGAATGTTGGCCAGG - Intergenic
958028150 3:88073495-88073517 CAGAAAAGGAATTGAGGGCCTGG + Intronic
958140338 3:89554573-89554595 AAGCAGATGATATGAGGGCCAGG - Intergenic
958853309 3:99354765-99354787 TAGAAGATGAAAATTGGGCCTGG - Intergenic
959093688 3:101930643-101930665 AAAAAGAGGAAACATGGGCCAGG - Intergenic
960397321 3:117153318-117153340 GAGAAGAGAAAATCTGGGCAGGG - Intergenic
960529903 3:118752743-118752765 AGGAAGAGGAAATGTGGTCAGGG + Intergenic
960591973 3:119375378-119375400 AAGAAAAGGCAATGTGGCCCTGG - Intronic
960627462 3:119695114-119695136 AAAAAAGGGAAATGTGGGCGCGG + Intergenic
961066280 3:123879947-123879969 AACAAAGGTAAATGTGGGCCAGG - Intronic
961170586 3:124795194-124795216 ATAAAGAGGAATTCTGGGCCGGG + Intronic
961553901 3:127684808-127684830 AAGAAGAGTGAAGGTGGGGCTGG + Intergenic
962206276 3:133437227-133437249 AAGAAAAGGAACTGAGGGCTGGG + Intronic
962968919 3:140380884-140380906 AAGAAGTGTAGTTGTGGGCCTGG + Intronic
963240606 3:142999279-142999301 ATGAAGAGGAGAAGTGGGACTGG - Intronic
963661434 3:148132469-148132491 AAGAAGAGAAAACTAGGGCCTGG + Intergenic
963986984 3:151607614-151607636 AAGAAGTGGGAACATGGGCCAGG + Intergenic
964292742 3:155199587-155199609 AAGAAGGGGAAATTTGAGGCCGG + Intergenic
964351933 3:155811714-155811736 AAGAAAAGGAAAAGAAGGCCGGG + Intergenic
964494920 3:157278410-157278432 GAGCAGAGGGAATGTGGGACAGG + Intronic
964691128 3:159451100-159451122 AAGAATACTAAATGTGGGCCGGG - Intronic
965126680 3:164639540-164639562 AATAAAAAGAAATGTTGGCCGGG - Intergenic
965362610 3:167760149-167760171 AAGAAGATTAAAAGTTGGCCAGG + Intronic
965400345 3:168205987-168206009 AAGATGGGGAAAAGGGGGCCGGG - Intergenic
965619691 3:170630273-170630295 AAGAGGGGGAAATGTGGGTAAGG + Intronic
965927980 3:174006771-174006793 AAGAAGAGGAGATTAAGGCCAGG + Intronic
966112404 3:176418979-176419001 AAAAAGGGGAAATAGGGGCCGGG + Intergenic
966161343 3:176972148-176972170 TAAAAGATAAAATGTGGGCCGGG + Intergenic
966202152 3:177368520-177368542 AAGAAGTGGAAATACAGGCCAGG - Intergenic
966436059 3:179885349-179885371 AAAAAGGGGAAATTTGGGCCAGG + Intronic
966686902 3:182705320-182705342 AAGCAGGGGAAATGTTGGCGTGG + Intergenic
967097842 3:186192302-186192324 GATAAAAGAAAATGTGGGCCAGG - Intronic
967229427 3:187323674-187323696 AAGAAAAGGAAATGAGAGCAGGG + Intergenic
967366955 3:188698168-188698190 ATGAAGATGAAACGTGTGCCTGG + Intronic
967404140 3:189098155-189098177 AAGAAGAAGAAAAGAGAGCCGGG + Intronic
967408374 3:189142251-189142273 ATGGAGAGGAAAGCTGGGCCAGG + Intronic
967570816 3:191026387-191026409 AAGAAGAGAAAACTTGGGCCTGG - Intergenic
967633572 3:191775558-191775580 AAGAAAAAGAAATGTGGGTCTGG - Intergenic
967704194 3:192630851-192630873 AAGAAAAAAAAAAGTGGGCCGGG - Intronic
967913150 3:194558528-194558550 AAGAAAAGTAGATATGGGCCAGG + Intergenic
967939038 3:194752349-194752371 AAAGAAAGGAAATATGGGCCGGG - Intergenic
968216225 3:196893612-196893634 AAGAAGAGTAAGTTTAGGCCGGG + Intronic
968586038 4:1416489-1416511 AAGGAGAGGAAGGGTGGGCAGGG - Intergenic
968764279 4:2459923-2459945 AAGCAGAGGGAAGGTGGGCAAGG + Intronic
968793222 4:2683586-2683608 AAAAAGAGAAAATCTTGGCCAGG - Intronic
969076653 4:4584444-4584466 AATAAGAGGAAATGTGAAACAGG - Intergenic
969401314 4:6957499-6957521 AAGGAGAGGAAGTGTGCCCCCGG - Intronic
970557297 4:17247304-17247326 AAGAAGTACAAAAGTGGGCCAGG + Intergenic
971000533 4:22317422-22317444 AAGACAAGGAATTGTCGGCCGGG + Intergenic
971219850 4:24694974-24694996 AACAAGAAGAAAAGGGGGCCAGG - Intergenic
971284074 4:25270305-25270327 AACAAGAGGAAAGGGGGGTCAGG - Intronic
971333537 4:25701994-25702016 TAGAAGAGGAAATCTAGGCCAGG - Intergenic
971336356 4:25727345-25727367 TAGAAGAGGAAATTTGGGGCAGG - Intergenic
971402567 4:26289748-26289770 AAGCTGAGGAAAGGTGGCCCAGG + Intronic
971456497 4:26850251-26850273 AAAATGGGGAAATTTGGGCCCGG + Intergenic
971793692 4:31199846-31199868 AAAAAGTGGTAATGTGGGCTGGG - Intergenic
972218201 4:36921111-36921133 ATAAGGAGAAAATGTGGGCCGGG + Intergenic
972239950 4:37179491-37179513 AAGAAGAAGAAATCTGAGCTAGG + Intergenic
972538162 4:40016408-40016430 AAGAAAAGGAAAAGTTAGCCAGG + Intergenic
973063851 4:45763398-45763420 CAAAAGAGGAAATGTGGGGTTGG - Intergenic
973839508 4:54846587-54846609 AAGAAGAGGAGATTAGGGCAGGG - Intergenic
973983296 4:56325037-56325059 AAGAAAGATAAATGTGGGCCAGG + Intronic
974066277 4:57080686-57080708 AAGAAAAGAAAATGTCAGCCAGG - Intronic
974353557 4:60782531-60782553 AAGATGAGGAAATGTAGTCTTGG - Intergenic
974701474 4:65453983-65454005 AATAATATGAATTGTGGGCCAGG + Intronic
975349756 4:73331908-73331930 AAGAATAGAGAATCTGGGCCAGG - Intergenic
975430756 4:74288056-74288078 AAGAAGAGGAAATTTGGACATGG - Intronic
975504660 4:75124631-75124653 ACAAAGAGGAAATGCTGGCCAGG - Intergenic
975583045 4:75923831-75923853 AAGAAAAGGGAAGATGGGCCGGG - Intronic
976263721 4:83170915-83170937 AAGAAGAAGAGATGTGGGGGCGG - Intergenic
976830207 4:89307105-89307127 AAGAAGAGGAAGGGCGGGCAGGG - Intronic
977148948 4:93484236-93484258 AGGAAAAGGAAATGGGGGCTGGG - Intronic
977208928 4:94195304-94195326 AAGAAGAGGAGATTAGGGGCTGG - Intergenic
977248437 4:94661096-94661118 AAGAAAAGAAAATTAGGGCCAGG + Intronic
977342415 4:95775500-95775522 AAGAGTAGTAAAAGTGGGCCGGG - Intergenic
977526687 4:98154650-98154672 AAGAAGAGGAAATTTAGACATGG - Intergenic
977526845 4:98156636-98156658 AAGAAGAGGAAATTTAGACACGG + Intergenic
977870446 4:102083931-102083953 AAGAAAAGGAAATTTGGACATGG + Intergenic
978341540 4:107725217-107725239 AGGAAGAGAAAATCAGGGCCTGG - Intergenic
978481177 4:109192557-109192579 AAGAAAAGAGAAGGTGGGCCTGG + Intronic
978482006 4:109203454-109203476 AAGAAGAAGAAATGGGACCCAGG + Intronic
978833954 4:113124832-113124854 AGGAAGAGAATATGTGGGCTGGG + Intronic
979935191 4:126684970-126684992 AAAAAGGGGAAATTTGGGGCCGG - Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
980961582 4:139481273-139481295 GAGAAGAGGAAATCTGGGCTGGG - Intergenic
981779086 4:148405412-148405434 AACAAGAGGTGATGTGGTCCTGG - Intronic
982080762 4:151787236-151787258 AAAAAAAGGAAGTATGGGCCAGG - Intergenic
982423931 4:155234450-155234472 AAGGAAAGGAAATGTAGGCATGG - Intergenic
983158318 4:164379688-164379710 AAGAATAACAAATGTTGGCCGGG + Intronic
983596602 4:169474567-169474589 GAGAAGAGGCAATGTGAGCTTGG - Intronic
983625879 4:169801507-169801529 AAGAAGAGGAGATTAAGGCCAGG - Intergenic
983783367 4:171701017-171701039 ATGAAGAGGAATTGTGCTCCAGG - Intergenic
983803524 4:171965359-171965381 AAGAAGAGTCAATGGGGGCTGGG + Intronic
984730804 4:183066377-183066399 AAAAAGTGGAAATCAGGGCCAGG + Intergenic
984838129 4:184041044-184041066 AAGAAGAGGAAATTTGGGCTTGG + Intergenic
984882342 4:184421100-184421122 AAGGAGAGGAAATGTCAGCAGGG + Intronic
984889919 4:184482703-184482725 CAAAAAAGGAAATGTGGGCCGGG - Intergenic
984910351 4:184668524-184668546 GACTAGAGGAAATGTGGCCCAGG - Intronic
985034272 4:185822275-185822297 AAGTGGAGGAAATGGAGGCCCGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985279561 4:188271788-188271810 AAGAAGAAGAAGGGAGGGCCGGG - Intergenic
985435120 4:189921657-189921679 CAGCAGAAGCAATGTGGGCCAGG + Intergenic
986064634 5:4223490-4223512 CTGAAGAGGAAGTGAGGGCCTGG - Intergenic
986246218 5:6009306-6009328 AAGAAGAGAAGAAGTTGGCCTGG - Intergenic
986647377 5:9930598-9930620 AAGAAGAGGAAGAGTTGGCCGGG - Intergenic
986668630 5:10124840-10124862 CAAAAGGGGAAATTTGGGCCAGG + Intergenic
986707960 5:10466961-10466983 AAGAAGAGGAAACGAGGACACGG - Intronic
987028390 5:13951513-13951535 AAAAAGAGAGAATATGGGCCAGG - Intergenic
987372725 5:17207859-17207881 AGGAAGAGGCAACCTGGGCCAGG - Intronic
987602502 5:20090239-20090261 AAAAACAGTAAATGTGGGCAGGG + Intronic
987777264 5:22384227-22384249 AAGAAAAGAAAATGTTGGCCGGG + Intronic
988774331 5:34463714-34463736 AAGAGGAGGAAAAGCAGGCCAGG + Intergenic
989161163 5:38393031-38393053 AAGAAAAGGCATTGTGGGCCAGG - Intronic
989484765 5:41976820-41976842 GTGAAGAGGAAATGTGGAGCTGG - Intergenic
989517788 5:42363501-42363523 AAGAAAAACAAATGTTGGCCGGG - Intergenic
990493725 5:56326288-56326310 AGGAAGTGGCAATGTGGCCCTGG + Intergenic
990573893 5:57106405-57106427 TAGAAGAGGAAATGTTGGATAGG - Intergenic
992062162 5:73063841-73063863 AGAAAGAGGAGTTGTGGGCCTGG - Exonic
992164928 5:74040046-74040068 AAGAAGTTGAAATGTGGTGCAGG + Intergenic
992701503 5:79345809-79345831 CAGAGGAGGAAATTAGGGCCTGG + Intergenic
992834042 5:80622614-80622636 AATAAGAGAAAATGGGGACCAGG + Intergenic
993390956 5:87319323-87319345 CAGAGGGGGAAATGTGGGACTGG - Intronic
993930024 5:93926426-93926448 AAGAATTGGAAATATAGGCCGGG - Intronic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
994627200 5:102235031-102235053 AAGGAGAGGAGCTGTGGGTCAGG - Exonic
995450124 5:112291218-112291240 ATGAAGTGGAAAGGTGGGCAGGG - Intronic
995559431 5:113364609-113364631 ATGAAGGGGAAATGTGGGATTGG - Intronic
995610737 5:113908105-113908127 AAGAACAGGAAGTTTGGGCTGGG + Intergenic
995683160 5:114743314-114743336 AAGGATAGGAAGTGTGGGACTGG - Intergenic
995788874 5:115861840-115861862 AAGAAAAGAAAATTTTGGCCTGG - Intronic
995921355 5:117317979-117318001 AAGAGGAAGAAATGTGAGACTGG - Intergenic
996494442 5:124137782-124137804 AAGTAGAGAAAATGTGAGCAAGG - Intergenic
997214512 5:132099605-132099627 AAGAAGACTATATGTGGGGCAGG - Intergenic
997368369 5:133340143-133340165 CAGATGAGGAAATGAGGCCCAGG - Intronic
997506472 5:134421587-134421609 AAGAAGAAGAAAGGTGGTCTCGG - Intergenic
997595509 5:135104570-135104592 AAGAATAGCTAAGGTGGGCCGGG - Intronic
997850052 5:137324147-137324169 AAAAAGAGAAAATTTTGGCCAGG + Intronic
998075644 5:139234074-139234096 GAGAAGAGGAAATGCAGGCAAGG + Intronic
998158660 5:139800568-139800590 TAGAAGAGCAAGTGAGGGCCGGG - Intronic
998408209 5:141886701-141886723 AAAATGAGGAAAGCTGGGCCAGG - Intergenic
999285993 5:150394619-150394641 AAGCAGCAGAAAAGTGGGCCTGG + Intronic
999387421 5:151164347-151164369 AAATAAAGAAAATGTGGGCCAGG - Intergenic
999392409 5:151203212-151203234 CACAAAAGGAAATGTAGGCCAGG + Intronic
999737823 5:154526021-154526043 AATAAAAGCTAATGTGGGCCAGG - Intergenic
999884919 5:155911626-155911648 AAGAAGAGGATATCAGAGCCAGG - Intronic
1000283949 5:159810291-159810313 AAGAAGAGGAAATGTGGAAAGGG + Intergenic
1000909678 5:167006964-167006986 TAAAAGATGGAATGTGGGCCGGG - Intergenic
1001143584 5:169164974-169164996 AAGATGAGGAAATCTAGGTCTGG - Intronic
1001319775 5:170670923-170670945 AAGAAGAGGACATCTGGAGCAGG + Intronic
1001942249 5:175749031-175749053 AAGTAGAGGGAATCTGGTCCTGG + Intergenic
1002029455 5:176416931-176416953 AAGAAGAGGAAAATTGAGGCTGG + Intergenic
1002162935 5:177327383-177327405 AAAAACAGAAAATTTGGGCCGGG + Intergenic
1002219183 5:177665608-177665630 ATGAATAAGAAATGTTGGCCGGG + Intergenic
1002526543 5:179818777-179818799 AAGATGAGGAAATGAGAGGCTGG + Intronic
1003136813 6:3440409-3440431 AAGAAGAGGAGATGAGTGGCCGG + Intronic
1003617750 6:7670704-7670726 AAGAAAAGGAAATTAGGACCCGG - Intergenic
1003631873 6:7794730-7794752 AAGGTGAGGAAATGTGAGGCAGG + Intronic
1003668362 6:8132411-8132433 AAGAAGAGGAAATGTGGACATGG - Intergenic
1004174308 6:13325928-13325950 AAGTAGAGGAATTGAGGGTCAGG - Intronic
1004205038 6:13584637-13584659 GAGAAGAGGACAGGTGGGCGCGG - Intronic
1004303254 6:14477242-14477264 AAGAGGAGGAAATGTGGGAGCGG + Intergenic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004523111 6:16380994-16381016 GAAAAGGGGAAATGTGGGCTGGG + Intronic
1004588819 6:17029238-17029260 AAGAGGAGGAAGGGTGGGGCAGG + Intergenic
1004885226 6:20044656-20044678 TAGAAAAGGAAATGTGGTTCTGG + Intergenic
1005044585 6:21629568-21629590 AAGAAGAAGCAATGGTGGCCTGG - Intergenic
1005584345 6:27261123-27261145 CAAAAGAAGAAATGTGGGCGAGG + Intergenic
1005911157 6:30310739-30310761 AAGAATAGAAAATCTGGGCCAGG + Intergenic
1005963497 6:30710382-30710404 AAGAAAAGAAAATGTAGGCCGGG - Intronic
1005966792 6:30732262-30732284 AAGAAGATGAAATCTAGGCTGGG - Intronic
1006262875 6:32891526-32891548 GAGAAAAGAAAATGTTGGCCAGG + Intergenic
1006334735 6:33414747-33414769 AAGAAGAGGAAATGTTTGTTTGG + Exonic
1006782470 6:36641337-36641359 AAGAAAAGGAAGTGTGGACATGG + Intergenic
1007329775 6:41096783-41096805 AAGAAGATGAAATGGGAGTCAGG + Intronic
1007342183 6:41198288-41198310 AGGAAGAAGAAGTGTGAGCCTGG - Exonic
1007377380 6:41466172-41466194 AAGAAAAGGAGAAGGGGGCCGGG + Intergenic
1007461042 6:42019190-42019212 ACAAAAAGGAAATGTAGGCCTGG + Intronic
1007478092 6:42132551-42132573 AAGAAAAGGAGGTGTGGGGCTGG + Intronic
1007503769 6:42318538-42318560 AAGTAAAGGAAATGTGGGTTAGG + Intronic
1007704081 6:43780655-43780677 AAGAAGTGGTAAGGTGGGCAGGG - Intronic
1007764922 6:44154663-44154685 GAGGAGAGGAAATGGGGGCAAGG - Intronic
1008342812 6:50388346-50388368 TAAAAAAGGAAATGTGGGCTGGG + Intergenic
1008563030 6:52740480-52740502 AAGAAGAGAAAATGGGAGCCTGG - Intergenic
1008565781 6:52766621-52766643 GAGAAGAGAAAATGGGAGCCTGG - Intergenic
1008577434 6:52874398-52874420 GAGAAGAGAAAATGAGAGCCTGG - Intronic
1009436667 6:63626406-63626428 AAAAATATTAAATGTGGGCCGGG + Intergenic
1009550735 6:65088819-65088841 AAGAAGGGGGACTCTGGGCCTGG - Intronic
1010885898 6:81240210-81240232 AAAAAGAGTAAACTTGGGCCGGG + Intergenic
1011077445 6:83452421-83452443 AGCAAGAGTAAATGTAGGCCAGG + Intergenic
1011165935 6:84445918-84445940 AAGAAGAGGAAATGTGATGGAGG - Intergenic
1011470645 6:87704407-87704429 CAAAAAAGGAAATTTGGGCCAGG + Intergenic
1011832541 6:91390856-91390878 AACAAGAGGTAATGGGGGCCAGG + Intergenic
1012789190 6:103671925-103671947 AAGGAGATCAAAAGTGGGCCTGG - Intergenic
1012810023 6:103945065-103945087 AAAAAGAGGCAAACTGGGCCTGG - Intergenic
1013136704 6:107289393-107289415 AAGAAAAAGAAATGGAGGCCAGG + Intronic
1013362603 6:109408183-109408205 AAGCAAAGGAAATGTGAGCAAGG - Intronic
1013386629 6:109638298-109638320 AAGAGGAAGAAAAGTGGGCTTGG - Intronic
1014019907 6:116575063-116575085 AAAAAGAGTAAAGCTGGGCCAGG - Intronic
1014042978 6:116850904-116850926 AAGGAGAAGAAATGTGGGGTTGG + Intergenic
1014246111 6:119070972-119070994 AATAGGAGGTAATGGGGGCCAGG - Intronic
1014680927 6:124429341-124429363 AAAAAGAAAAAATATGGGCCAGG - Intronic
1014835645 6:126157192-126157214 AAGAAGAGGAAGTGTGGACGAGG - Intergenic
1014961682 6:127694658-127694680 AAGAAGAGGAAATTTGGACATGG - Intergenic
1015151835 6:130048700-130048722 AGAAAGAGGAAATGTGGCACTGG + Intronic
1015168845 6:130228821-130228843 AGGAAGAAGGAATGTGGGCTTGG - Intronic
1015825057 6:137302477-137302499 AAGACGAAGAAATGTGTGACTGG - Intergenic
1016950868 6:149578225-149578247 AAGAATAGGAAAGATGGGCCAGG + Intronic
1016977421 6:149822999-149823021 AGGAAGAAGAAAGGTGAGCCAGG + Intronic
1017819215 6:158037694-158037716 AAGATGAGGACAACTGGGCCGGG - Intronic
1018049020 6:159991662-159991684 ACTAAAAGGAAATGTGGGCTGGG - Intronic
1018154521 6:160973382-160973404 AGGAAGTGGCCATGTGGGCCAGG + Intergenic
1018214797 6:161516530-161516552 AAAAAGAAGAAAAGTGGGCTAGG + Intronic
1018282289 6:162199902-162199924 CAGATGAGGAGCTGTGGGCCAGG - Intronic
1018515893 6:164579780-164579802 AAGATGAGGAAAAGCAGGCCGGG - Intergenic
1018532328 6:164780774-164780796 AACAACACGAATTGTGGGCCAGG + Intergenic
1019495864 7:1340381-1340403 AAGAAGAAGAAAGGAGGGCTGGG + Intergenic
1019826535 7:3289257-3289279 AAAAAGAGGAAATTAGGGCGGGG - Intergenic
1020050750 7:5080078-5080100 AAAAAAAAAAAATGTGGGCCGGG + Intergenic
1020108230 7:5432642-5432664 AAAAAGAGGACATTTGGGCTGGG + Intronic
1020135123 7:5583268-5583290 AAAAAGAAAAAAAGTGGGCCAGG + Intergenic
1020200404 7:6075399-6075421 AAGAAAAAGTAATGTTGGCCGGG - Intergenic
1020418943 7:7977811-7977833 CAGATGAGGAAATGAGGTCCTGG + Intronic
1020432577 7:8128715-8128737 AAGCAAAGGAAAAGTGGGTCTGG + Intronic
1021012911 7:15493668-15493690 GGGAAAAAGAAATGTGGGCCGGG - Intronic
1021090535 7:16477799-16477821 TTAAAGAGAAAATGTGGGCCGGG + Intronic
1021252954 7:18354698-18354720 AAGTGGAGGAAATCTGGGCCTGG - Intronic
1021444484 7:20717730-20717752 AAGAAGAGGAAATTTGGGCCAGG - Intronic
1021905404 7:25328376-25328398 AAAAGGGGGAAATTTGGGCCAGG + Intergenic
1022114348 7:27249360-27249382 GAGAAGAGGAAGTGGGAGCCCGG - Intergenic
1023176217 7:37438126-37438148 AACAAGAGGAAAGGTGGGGTTGG - Intronic
1023214205 7:37844299-37844321 AAAAAGAAGAAATCTGGTCCAGG - Intronic
1023349011 7:39300723-39300745 AAGAAGAGGAAATTTAGACATGG - Intronic
1023964717 7:44957154-44957176 AAGAAAAGAAAAAGTGGGGCGGG + Intergenic
1024183753 7:46926434-46926456 TAAAAGATAAAATGTGGGCCGGG + Intergenic
1024230262 7:47358430-47358452 TAAAAGAGGAAATGTTGGCCAGG - Intronic
1024667285 7:51559519-51559541 CAGAAAAAGAAATGTGGGGCTGG + Intergenic
1024982932 7:55172755-55172777 AAAATGAGGAAAAGTGTGCCTGG + Intronic
1025064326 7:55840190-55840212 AAGAAGATAAAATGTGAGGCCGG + Intronic
1025088328 7:56041595-56041617 AAGAAGAGAAAATTTGGACATGG + Intronic
1025237853 7:57246667-57246689 AAGAAGAGAAAGTGGGGGCCAGG - Intergenic
1025900484 7:65740421-65740443 AAGAAGAGAAAATTTGGACATGG + Intergenic
1025908277 7:65806708-65806730 AAAAAAAGGGAATGGGGGCCAGG - Intergenic
1026253426 7:68690605-68690627 AAAAAGAGGGAATTTTGGCCGGG + Intergenic
1026645298 7:72162436-72162458 ACAAAGAGGATATATGGGCCAGG + Intronic
1026688521 7:72533125-72533147 AAAAAGGGGAAATGGGTGCCAGG - Intergenic
1026795268 7:73362325-73362347 AAAAAGATGTAATGGGGGCCAGG - Intergenic
1026852414 7:73733364-73733386 AAGAACAAAAAATGTGGGCTGGG + Intergenic
1027590796 7:80116447-80116469 AAGAACATGAATAGTGGGCCAGG + Intergenic
1027598599 7:80209605-80209627 ACAGAGAGGAAATGTGGGCTAGG + Intronic
1027888440 7:83938877-83938899 AAGAAGAGGCCATGTGAGCTTGG - Intergenic
1029090748 7:98046206-98046228 AAGAAGAGGAATGAGGGGCCAGG + Intergenic
1029595802 7:101537118-101537140 AAGAAGGGGCATTGGGGGCCAGG + Intronic
1029641284 7:101821631-101821653 AAGAAAAGAAAATAGGGGCCGGG - Intronic
1029901586 7:104046845-104046867 AAGAATATAAAATGTGGGCCAGG + Intergenic
1029986550 7:104928148-104928170 AAGAAGAGGAAATTTGGGCTGGG + Intergenic
1030140491 7:106299297-106299319 AAGAAATTGTAATGTGGGCCGGG + Intergenic
1030186290 7:106765404-106765426 AAAGAAAGGCAATGTGGGCCGGG + Intergenic
1030204793 7:106942374-106942396 AAAAAAAAAAAATGTGGGCCAGG - Intergenic
1030580632 7:111350259-111350281 AAGAAGGGAACATCTGGGCCAGG - Intronic
1031071024 7:117161893-117161915 CAGAAAAGAAAATGAGGGCCAGG - Intronic
1031139722 7:117928757-117928779 AAGAAGAGGAAAAGAGGTACTGG + Intergenic
1031176069 7:118352502-118352524 AAGAACAGAAAATGCGGGTCTGG + Intergenic
1031186029 7:118481373-118481395 ATGGAAAGGAAATGTGGGGCAGG - Intergenic
1031974646 7:128086020-128086042 CAGAAGAGGAACTGTGGGTGTGG - Intronic
1032071264 7:128808714-128808736 AAAAGGAGGAAACGTGAGCCTGG - Intronic
1032329349 7:130963154-130963176 AAGAATAGGAAATACGGGGCCGG - Intergenic
1032667293 7:134049375-134049397 AGGAAGGGGAAAGGTGGGCAAGG - Intronic
1032858290 7:135854999-135855021 AATAAGAAGAAATATAGGCCAGG - Intergenic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1033290149 7:140076644-140076666 AAGAAGAGGAAATTTAGGCCAGG + Intergenic
1033535941 7:142312386-142312408 AATAAGAGGAGAGATGGGCCAGG + Intergenic
1033582828 7:142752384-142752406 AGGAAGTAGAAATGTGGGTCAGG - Intronic
1033672029 7:143502442-143502464 AAGAAGAAGAAGTGTGGGTGTGG + Intergenic
1033707984 7:143906988-143907010 GTGAAGGGGAAAAGTGGGCCTGG - Intergenic
1033879284 7:145861743-145861765 AAGAAGAGGAAGAGTGGGAGGGG + Intergenic
1033916536 7:146333238-146333260 TACAAGAAGAAATGGGGGCCGGG - Intronic
1034022034 7:147655106-147655128 AAGAAAAAGAAATATGGGCCAGG - Intronic
1034122450 7:148639990-148640012 AAGAAGAGGAAATTGGGACACGG - Intergenic
1034171799 7:149068384-149068406 AAAAATATAAAATGTGGGCCAGG - Intergenic
1034183480 7:149156561-149156583 AAGAACAGTAATTGTAGGCCAGG + Intronic
1034191325 7:149215624-149215646 TAGAAGAGCCAGTGTGGGCCTGG + Intronic
1034428904 7:151030520-151030542 AATAAAAGTAAATGTAGGCCAGG + Intronic
1034443007 7:151096765-151096787 AAGAAAAGAAAATTTAGGCCAGG - Intronic
1035077891 7:156193060-156193082 TAGAAGAGGAGATGTGGACATGG - Intergenic
1035201123 7:157267126-157267148 TAAAAAAGCAAATGTGGGCCAGG + Intronic
1035204677 7:157287474-157287496 CAGAAGAGGACATGGAGGCCAGG - Intergenic
1035454808 7:159001156-159001178 ATGAGAAGGAAATGAGGGCCTGG - Intergenic
1035681067 8:1488487-1488509 GGGAAGATGAAACGTGGGCCAGG - Intergenic
1035842105 8:2824418-2824440 TAGGAGAGCTAATGTGGGCCGGG - Intergenic
1036435077 8:8725646-8725668 GAAAAGGGGAAATTTGGGCCGGG + Intergenic
1037317502 8:17612664-17612686 AAGAAAAGAAAAACTGGGCCAGG - Intronic
1037970080 8:23165463-23165485 AAGAAAAAAAAATGTGTGCCAGG + Intergenic
1037971683 8:23176593-23176615 AAGAAGAGGAAAGATGAGACTGG + Intergenic
1038060349 8:23905444-23905466 AAGAAGAGGAAATGTGGGGAGGG - Intergenic
1038459530 8:27704148-27704170 AAGAAGAGTGAATATTGGCCAGG + Intergenic
1038516787 8:28194128-28194150 TAGAAGAGGAAGAGTGGGGCCGG - Intergenic
1038768248 8:30450579-30450601 AAGAAGTGGAACTGAAGGCCTGG - Intronic
1039148667 8:34479040-34479062 ATGGAGAGGAAATGTGGGGTTGG - Intergenic
1039271383 8:35884284-35884306 AAGAATAGCATTTGTGGGCCAGG - Intergenic
1039564854 8:38544046-38544068 AAAAAGAGGCAATTTGGGCCAGG + Intergenic
1040027214 8:42792809-42792831 AAGAAAAGGGAAGGTGGGCCAGG + Intronic
1040686015 8:49874394-49874416 AAGAAGAGGAAATGTAGTAGAGG - Intergenic
1040851062 8:51900121-51900143 AAGAAGAGGAAATGAGGCATAGG + Intergenic
1040904996 8:52459290-52459312 GGGAAGAGGAAATGAGGGCAGGG - Intronic
1041247902 8:55906231-55906253 AAGAAGAAAATAAGTGGGCCAGG + Intronic
1041461347 8:58115181-58115203 AAGAAAAGGAAAATTGAGCCAGG - Intronic
1041596768 8:59664174-59664196 AAGAAGAGCAAATTTAGACCAGG + Intergenic
1041941520 8:63393207-63393229 AAAAATAGGAAATGTGGTCCTGG + Intergenic
1042257127 8:66816637-66816659 GAAAATAGGAAATGTTGGCCGGG - Intronic
1042271138 8:66956907-66956929 AAGAAGAGGAGAATCGGGCCGGG + Intronic
1042297674 8:67239299-67239321 AAGAAAGGGAAAGGAGGGCCAGG - Intronic
1042552285 8:70004816-70004838 AAGAAAAGGAAAAAAGGGCCGGG + Intergenic
1042831427 8:73033432-73033454 AAGAAAAGGAAATGTAGGCCAGG + Intronic
1043583597 8:81740612-81740634 AAGGAGTAGAAATGTGGGTCAGG - Intronic
1043676914 8:82968112-82968134 ACGAAGAGAAAATGGGGGCAGGG + Intergenic
1044639096 8:94359914-94359936 AACAAAGGGAAATGTGGGACAGG - Intergenic
1044884574 8:96763095-96763117 AAGAAGAGGAAAGTTGGACAGGG - Intronic
1044975532 8:97661645-97661667 AACAAAAGAAAATGTGGGCCAGG + Intronic
1045025918 8:98086653-98086675 ACTGAAAGGAAATGTGGGCCGGG + Intronic
1045213575 8:100124416-100124438 AAAATGAGGAAATGTAGGCCAGG - Intronic
1046959322 8:120093687-120093709 AAGACAAGAAAATGTGGGGCCGG - Intronic
1047492732 8:125387817-125387839 AAAAAAAGGAAATGTAGGCTGGG + Intergenic
1047611101 8:126521639-126521661 AAAAAGAACAAATGTAGGCCGGG - Intergenic
1047648072 8:126889811-126889833 AGAAAATGGAAATGTGGGCCTGG - Intergenic
1047755511 8:127915312-127915334 TAAAAGAGGACATGTGGGCCAGG + Intergenic
1047786061 8:128154818-128154840 AAGAAAAGGAGATTAGGGCCGGG - Intergenic
1047815643 8:128459742-128459764 AAGAAGTGATAATCTGGGCCAGG + Intergenic
1047959033 8:129997437-129997459 AAGCAGATGAAATGTGGGTAAGG + Intronic
1048221805 8:132549178-132549200 AAGAAAAGGTAATAAGGGCCAGG + Intergenic
1048847155 8:138612629-138612651 AAAAAGGGGAACTTTGGGCCAGG + Intronic
1049165789 8:141125083-141125105 AAAAATAAGAAATGTGGGCGAGG - Intronic
1049593048 8:143471313-143471335 CAGAAGAGGCAGTGTGGGGCGGG + Intronic
1049701417 8:144015444-144015466 AAAGAAAGAAAATGTGGGCCAGG + Intronic
1049953379 9:668024-668046 AACAAGAGGAATTTTGGGCTAGG - Intronic
1050272388 9:3959854-3959876 AGAAAGAGGAAATTTGGGCCGGG + Intronic
1050326746 9:4505342-4505364 AAAAAAAGGAAATATGGGCCGGG - Intronic
1050369514 9:4906411-4906433 AAGAAGAGAAAATGTGGCCTGGG + Intergenic
1050454829 9:5824276-5824298 AAGAAAAGGCAAAGAGGGCCAGG + Intronic
1050762374 9:9088290-9088312 AATAAAATGAAATCTGGGCCGGG + Intronic
1050763290 9:9100462-9100484 TAGAAGAAGAAATGTGGGGGTGG - Intronic
1051188962 9:14491043-14491065 AAGAAGCCCAAATGTGGGCTTGG + Intergenic
1051308013 9:15736645-15736667 AAGAAAAAGAAATGTGAGCCGGG - Intronic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1051860520 9:21620259-21620281 CAGAAGGAGAAATGTGGGTCAGG + Intergenic
1052124941 9:24763677-24763699 AAGAAAAGAATATGTGGGCCAGG - Intergenic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052776876 9:32741196-32741218 CAGAAGAGGCATTTTGGGCCGGG - Intergenic
1052786337 9:32831705-32831727 AAGAAGATGTAACATGGGCCAGG + Intergenic
1053023717 9:34713893-34713915 AAGAGGAGGAAATGAGTGTCAGG + Intergenic
1053045117 9:34909139-34909161 AAAAAGAGAAAAAGGGGGCCGGG - Intergenic
1053610861 9:39711760-39711782 AAGAAGAGAAGACTTGGGCCTGG + Intergenic
1053729753 9:41041537-41041559 AGGAAGAGGAAATGTGTGCTGGG - Intergenic
1053868897 9:42469782-42469804 AAGAAGAGAAGACTTGGGCCTGG + Intergenic
1054087393 9:60759398-60759420 AAGAAGAGAAGACTTGGGCCTGG - Intergenic
1054242661 9:62630635-62630657 AAGAAGAGAAGACTTGGGCCTGG - Intergenic
1054556785 9:66665153-66665175 AAGAAGAGAAGACTTGGGCCTGG - Intergenic
1054698752 9:68390525-68390547 AGGAAGAGGAAATGTGTGCTGGG + Intronic
1055636069 9:78280704-78280726 AATAAGAGTAGATTTGGGCCGGG + Intergenic
1055691833 9:78840504-78840526 AAGAAGAGGAAAAATAGGGCAGG + Intergenic
1055927270 9:81523580-81523602 AAGATGTGGAAATATCGGCCGGG + Intergenic
1056119499 9:83473217-83473239 GGGAAGAGGCAAGGTGGGCCAGG - Intronic
1056224658 9:84483180-84483202 GAGCAGAGGACCTGTGGGCCCGG + Intergenic
1056315603 9:85386663-85386685 AAGGAGAAGAAATGTCGGCTTGG + Intergenic
1057421800 9:94918798-94918820 AAGAATAAGGAATGTGGCCCTGG + Intronic
1057438670 9:95065462-95065484 GAGGAGAGGAAAAGGGGGCCTGG - Intronic
1057490538 9:95516556-95516578 AGGACGAGGAAAGGGGGGCCAGG - Intronic
1057538897 9:95945900-95945922 AAGAAGGAGAAAAGTGGGGCTGG + Intronic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1057829998 9:98399012-98399034 AAGAAGAGAAAAAGTGCTCCTGG - Intronic
1057932270 9:99204815-99204837 AAGGAAAGGAAATCTGGGCCAGG - Intergenic
1058403577 9:104645205-104645227 AAGAATAGAAAATGTAGGCCGGG + Intergenic
1058455382 9:105133461-105133483 AAGAACACGCCATGTGGGCCAGG - Intergenic
1058728549 9:107826810-107826832 GAAAAGATGAAATCTGGGCCGGG - Intergenic
1058745338 9:107985102-107985124 AAGCAGAGGAGATGTGGGTGTGG - Intergenic
1058805724 9:108589559-108589581 AAAAAGGGGAAATTTGGGTCAGG - Intergenic
1059029424 9:110675198-110675220 AAAAAGAGGCAATGTGGCACAGG - Intronic
1059663962 9:116428228-116428250 AAGAAGAGGAAAAGGTGGCCGGG + Intronic
1060142227 9:121220176-121220198 AAGAAAAGGCAGTGTGGGCCGGG - Intronic
1060162336 9:121375821-121375843 AAGAAGAAGAAATTTGGACACGG - Intergenic
1060548788 9:124475669-124475691 AAGGAGAGGATATGGGGGCTGGG - Intronic
1060721247 9:125980595-125980617 AAGAAGAAAAAAAATGGGCCGGG + Intergenic
1060927245 9:127463551-127463573 AAGAGGAGGGAATTTGGACCCGG - Intronic
1061125966 9:128675892-128675914 GAGGAAAGGAAAGGTGGGCCAGG + Intergenic
1061349810 9:130055170-130055192 AAGAAGTGGAACTGTAGGCGGGG + Intronic
1061689483 9:132314382-132314404 AAAAATACAAAATGTGGGCCGGG - Intronic
1061895076 9:133642936-133642958 CAGCAGAGGAAGTGTGGCCCAGG + Intronic
1062215328 9:135386033-135386055 CAGGAGATGAAATATGGGCCGGG - Intergenic
1062226611 9:135455913-135455935 GAGGGGAGGAAATGTGCGCCAGG - Intergenic
1062487927 9:136790174-136790196 AAAAAGATGAAATCTTGGCCAGG - Intergenic
1062593716 9:137287971-137287993 AAGAAGAGAATATTTGGGCCAGG + Intergenic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1203369052 Un_KI270442v1:285714-285736 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1185791840 X:2933063-2933085 AAGAAGAGGAGATTAGGGCCGGG + Intergenic
1186022096 X:5267946-5267968 AATAAAAGGACATGTGGGCCAGG + Intergenic
1186172094 X:6888344-6888366 ATCAAGAGGAAATTTGGGCCAGG + Intergenic
1186459022 X:9733670-9733692 AAGAAGAGGAATTGAGGGACAGG + Intronic
1186694788 X:12018710-12018732 AACAAGGGGAAATCTGGACCGGG - Intergenic
1187045923 X:15647295-15647317 AGGGAGAGGAGAGGTGGGCCTGG - Intronic
1187051901 X:15703596-15703618 AGGGAGAGGAGAGGTGGGCCTGG - Intronic
1187970603 X:24654400-24654422 TAAAAAAGGAAACGTGGGCCAGG - Intronic
1188259685 X:28008126-28008148 ACAAAGAGGAAATGTGGGGTTGG - Intergenic
1188406011 X:29810481-29810503 AATAAAAGGAAATGTGGGCTGGG - Intronic
1188421776 X:29998544-29998566 AAGAAGAGGAAATGAGGACAGGG + Intergenic
1188768280 X:34123724-34123746 AAAAAGAATAAATCTGGGCCAGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1188947759 X:36328513-36328535 AAGAAAAGCAAATTGGGGCCGGG + Intronic
1189127319 X:38462112-38462134 ACCAAGGGGAAATGTGGGCTTGG - Intronic
1189163771 X:38838539-38838561 AAAAATATGAAATGGGGGCCAGG - Intergenic
1189359551 X:40339101-40339123 AAAAAGAGAAGATATGGGCCGGG - Intergenic
1189516015 X:41714129-41714151 AAGAAGAGAAATTCTGGGACTGG + Intronic
1189547549 X:42057325-42057347 TAGAAGAGGAAGTGAGGGCTGGG - Intergenic
1189594360 X:42548410-42548432 ACCAAGAGGAAATGTGGGGTTGG - Intergenic
1189669468 X:43392619-43392641 AAGATGAGGAAATGAGAGGCTGG - Intergenic
1189752705 X:44238686-44238708 GAGGAGAGGAAATGTGCTCCAGG - Intronic
1189836743 X:45031075-45031097 GAGAAAAGGAAAGGTGTGCCAGG - Intronic
1189839387 X:45057191-45057213 AAGAATAGGAGATGTTGTCCTGG - Intronic
1190413404 X:50158945-50158967 AAGAAGAGGACACATGGGCCTGG + Intergenic
1190761810 X:53443226-53443248 AAAAAGAGTTAATATGGGCCGGG - Intergenic
1191062553 X:56314930-56314952 AAAAAAAGGAAGTGGGGGCCAGG - Intergenic
1191171594 X:57453406-57453428 AAGAAGAGGAACTGCTGGGCTGG - Intronic
1191834481 X:65449321-65449343 AAAAAAAGAAAATGTGGGCCAGG + Intronic
1192281369 X:69689628-69689650 AAGAAGAACAAAGTTGGGCCGGG - Intronic
1192409356 X:70919221-70919243 AACAAAAGCAAATGGGGGCCAGG - Intergenic
1192611259 X:72569732-72569754 AAGAAGAGGAAATGGGGAATAGG - Intronic
1192899692 X:75483299-75483321 AAAAAGAGAAAAAATGGGCCAGG + Intronic
1193179078 X:78432026-78432048 GAAAAGAGGAAATCTGGGCTAGG - Intergenic
1193427363 X:81355654-81355676 AGGAAGAGGAAGTGTAGGACAGG - Intergenic
1193900043 X:87166125-87166147 AGGAAGAGAAAACTTGGGCCTGG - Intergenic
1194284168 X:91989265-91989287 AAGAAGAAGAAAAGAAGGCCGGG + Intronic
1194360316 X:92941946-92941968 GTGAAGAGGAAATGTGGGATTGG - Intergenic
1195004218 X:100670666-100670688 AAGTAGAGGGAATGGGGACCAGG + Intronic
1195062500 X:101209889-101209911 AAGAAAAGGAAATAGTGGCCAGG - Intergenic
1195242072 X:102961707-102961729 AAGGAGAAGAAAAGTGGGCCAGG - Intergenic
1195260213 X:103124486-103124508 AGGGAGAAGAAAGGTGGGCCTGG + Intergenic
1195380027 X:104261511-104261533 AAGAAGAGGAAAAGTCGCCGAGG + Intergenic
1196654077 X:118198782-118198804 AAGAAAAGGAAATGTGGACACGG + Intergenic
1198379790 X:136073206-136073228 AGGCAGAGGAAATGGAGGCCTGG - Intergenic
1198439208 X:136645721-136645743 AAGGAGAGGATATATGGGCCTGG + Intergenic
1199134479 X:144234508-144234530 GCCAAGAGGAAATGTAGGCCGGG + Intergenic
1199720326 X:150538862-150538884 AAGAAGGGAACATTTGGGCCGGG + Intergenic
1199892444 X:152099588-152099610 GAGAAGAGGAAATGTGAGAAAGG + Intergenic
1200233386 X:154457220-154457242 AAGAATAGGAAAAGTTAGCCAGG + Intergenic
1200298710 X:154950058-154950080 AAGAAGAGGAAATGTGGGCCAGG - Intronic
1200397248 X:155998469-155998491 AGGAAGAGAAAATGGGGGCAGGG - Intronic
1200601735 Y:5213822-5213844 AAGAAGAAGAAAAGAAGGCCAGG + Intronic
1200668520 Y:6057764-6057786 GTGAAGAGGAAATGTGGGATTGG - Intergenic
1201014512 Y:9586708-9586730 CATAAGAGGAAAGGTGGGCCGGG + Intergenic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic