ID: 1200300288

View in Genome Browser
Species Human (GRCh38)
Location X:154967482-154967504
Sequence TTGATTATGAGGAACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200300281_1200300288 29 Left 1200300281 X:154967430-154967452 CCACAGGGCAATTTTGAAGATCA 0: 1
1: 0
2: 0
3: 15
4: 223
Right 1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200300288 Original CRISPR TTGATTATGAGGAACAGGGA AGG Intronic
901538806 1:9901373-9901395 TTGATCAGGAAGAACAGGGGTGG + Intronic
902652057 1:17843552-17843574 TAGAGGATGAGGAACAGGCAAGG - Intergenic
903762130 1:25706239-25706261 TTGCATAACAGGAACAGGGAAGG + Intronic
904534105 1:31187968-31187990 CTGGTTTTGAGGAGCAGGGAGGG + Intronic
904949428 1:34224467-34224489 TGTGTTATGAGGAACAGGGAAGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905539223 1:38746862-38746884 TTGATTAAGAGGTACAAGGCTGG - Intergenic
907105400 1:51878343-51878365 ATGAATCTGAGGAAGAGGGACGG - Exonic
907651288 1:56297158-56297180 TTGGTTATGGAGATCAGGGAAGG + Intergenic
908386250 1:63644427-63644449 TTCATTATGAGAAATAAGGAAGG + Intronic
909814347 1:79973347-79973369 TTGATTATGAGGAAACTGAAAGG + Intergenic
913542738 1:119837328-119837350 ATGATGATGAGGAAGAGGAAGGG - Intergenic
913565881 1:120071497-120071519 TTCATTAAGAGGAGGAGGGAAGG - Intergenic
913632250 1:120722056-120722078 TTCATTAAGAGGAGGAGGGAAGG + Intergenic
914286469 1:146230861-146230883 TTCATTAAGAGGAGGAGGGAAGG - Intergenic
914547500 1:148681603-148681625 TTCATTAAGAGGAGGAGGGAAGG - Intergenic
914619012 1:149388750-149388772 TTCATTAAGAGGAGGAGGGAAGG + Intergenic
915131691 1:153699555-153699577 TTGATTATGAGTGACAGAGCTGG - Intergenic
916686773 1:167154562-167154584 ATGATTAAGAGTAATAGGGAAGG - Intergenic
917505901 1:175626526-175626548 TTGAGAATTAGGGACAGGGAGGG - Intronic
919421441 1:197374569-197374591 TTGATGTTGTGGAATAGGGAGGG + Intronic
921745699 1:218738067-218738089 TTGATTAGGAGGAACATCCACGG + Intergenic
923241257 1:232087803-232087825 TAGATTATGAGGACTATGGAAGG - Intergenic
923883842 1:238133215-238133237 TTGATTATAAGAAAGAGGTAAGG - Intergenic
1063277258 10:4583500-4583522 TTTCTTATGAAGAACAGGAAAGG - Intergenic
1063942447 10:11144254-11144276 ATCATTATGAGCAAGAGGGACGG - Intronic
1064440436 10:15348576-15348598 TTGATGGTTAGGAACAGAGAGGG - Intronic
1065194547 10:23250449-23250471 TTTATTCTCAGGAACAGGTATGG - Intergenic
1067850536 10:49751244-49751266 TTGGCTATGAGGAAGAGAGAGGG - Intronic
1069323779 10:67205736-67205758 TTGTTTCTGAGGAAAAGGTAAGG + Intronic
1070511627 10:77166544-77166566 TTGATTCAGAGGAAGAGGAAGGG + Intronic
1071119541 10:82261666-82261688 TTCCTTATGGGAAACAGGGATGG + Intronic
1071274218 10:84038092-84038114 TTGAAGAAGAGGAATAGGGAGGG + Intergenic
1071424831 10:85538880-85538902 TTGATTCTGAGGAAGAGAAAAGG - Intergenic
1073021920 10:100452215-100452237 TGCAGTATGTGGAACAGGGAGGG - Intergenic
1077851614 11:6078800-6078822 TTGATACTGAGGGAGAGGGATGG + Intergenic
1077892703 11:6431072-6431094 TTTATTATGAGAAACTGGGGAGG + Exonic
1078839468 11:15064993-15065015 TTGATACTGAGGGAGAGGGACGG + Intronic
1079479606 11:20865570-20865592 TTTATTAGGAAGAACAGGCAGGG + Intronic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1081367719 11:42256665-42256687 TTGAGTATTGGGGACAGGGAGGG + Intergenic
1088627783 11:111744173-111744195 TTGATTAGGAAAAACAGTGATGG + Intronic
1089554962 11:119311182-119311204 TTGACTAGGAGGCAGAGGGAGGG + Exonic
1089839080 11:121398723-121398745 TTGAACATAAGGGACAGGGAGGG - Intergenic
1090404407 11:126468258-126468280 AGAAGTATGAGGAACAGGGAAGG + Intronic
1090446076 11:126765911-126765933 TTGATTATGGGGGGAAGGGAGGG - Intronic
1090527950 11:127557812-127557834 CTGAGAATGAGAAACAGGGAAGG + Intergenic
1090792807 11:130106574-130106596 TTGATTTTGAGGCAGAGAGATGG - Intronic
1090821640 11:130347806-130347828 TTGGTCATGAGGGACAGGGATGG - Intergenic
1090993260 11:131839923-131839945 TTGAGTATTAGAGACAGGGAGGG + Intronic
1092404607 12:8210331-8210353 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1094212957 12:27911308-27911330 TTGACTATGATGAAGAGGGAAGG - Intergenic
1095391728 12:41715144-41715166 TTAAATATGGGGAAAAGGGATGG - Intergenic
1096251325 12:50034508-50034530 TTGCTTATGCCAAACAGGGAAGG - Intergenic
1096532947 12:52253353-52253375 TTGCTTATGAGGCTCAGGGTGGG + Intronic
1097217360 12:57424600-57424622 TTGTTTATGAGGAACAGTATGGG - Intronic
1097692165 12:62743547-62743569 GTGGTTAAGAGAAACAGGGAGGG + Intronic
1097797138 12:63874617-63874639 TTATTTCTGAGGAAAAGGGAGGG + Intronic
1100619162 12:96255197-96255219 TTGAGTGTGAGGAACATGGGAGG + Intronic
1100983983 12:100187747-100187769 TTGATCCTGAGGATCTGGGAGGG + Intergenic
1101497135 12:105265366-105265388 TTTAGTATGAGGGAAAGGGATGG - Intronic
1102757469 12:115354605-115354627 CTGGTTATGAGGAACTGGGGTGG - Intergenic
1103195331 12:119038844-119038866 TGGAGGATGAGGAACAGTGAGGG - Intronic
1103253807 12:119523247-119523269 TTGGTTTTGAGGAACAAGCAAGG - Intronic
1104629892 12:130391485-130391507 TAGAGTAGGAGGAAAAGGGACGG - Intergenic
1106206515 13:27601318-27601340 TTAATGATGGGGAAGAGGGAGGG - Intronic
1110893353 13:80717236-80717258 TTTATTATGAGGAATAGGATAGG - Intergenic
1111263802 13:85779565-85779587 TTGATTATGATAATCAGAGATGG - Intergenic
1112117670 13:96374768-96374790 TTGATCATGAGGCACAAGGGAGG - Intronic
1114273922 14:21124279-21124301 TTGATGATGCAGAACAGAGAGGG - Intergenic
1121179775 14:91920123-91920145 TTGACTCTGAGGAGGAGGGAAGG - Intronic
1122622498 14:103067779-103067801 TTTATTATCAGGAAAAGGGAAGG + Intergenic
1124989053 15:34652669-34652691 TTGAAGAGGAGGAACAGGTAAGG - Intergenic
1125112442 15:36048948-36048970 TTGAAGCTGAGGAACAGAGAGGG + Intergenic
1125466726 15:39960599-39960621 GTGACTATGAGGAACAGGATGGG + Intronic
1125995731 15:44159056-44159078 ATCCTTAGGAGGAACAGGGATGG + Intronic
1127400739 15:58583529-58583551 CTGATTATGAGCAACAGGAAAGG - Intergenic
1127576795 15:60299636-60299658 GTGCTTATTAGTAACAGGGAAGG - Intergenic
1127857734 15:62966577-62966599 CTGTTTCTGATGAACAGGGAAGG - Intergenic
1128409553 15:67380729-67380751 TTGATTAGGAGAGAAAGGGATGG + Intronic
1128414408 15:67431219-67431241 TTTTATATGAGGAACAGGAATGG - Intronic
1128764972 15:70245828-70245850 TTGATAGTGAAGAACAGGGGAGG + Intergenic
1129811011 15:78509985-78510007 TTGGGTAGGAGGATCAGGGAAGG + Intronic
1130238954 15:82167390-82167412 TTGATTATGAGGAATTTGAAGGG - Intronic
1131259748 15:90882226-90882248 TTGCTTTAGAGGGACAGGGAAGG - Exonic
1131278391 15:91001370-91001392 TTTGGTATGTGGAACAGGGATGG - Exonic
1133638122 16:7689770-7689792 TCCATTAAGAGGAACAGGTAAGG + Intronic
1135224305 16:20642261-20642283 TTGAATGTGAGGAACAGGAAAGG + Intronic
1136101620 16:28000925-28000947 TAGAAGATGAGGAACAGGCAAGG - Intronic
1138579006 16:57927439-57927461 GTGACTATGAGAAACAGGGTGGG - Intronic
1138676839 16:58657509-58657531 TTTATTATGGGAGACAGGGAAGG - Intergenic
1139249297 16:65479646-65479668 GTGGTTTTCAGGAACAGGGAAGG + Intergenic
1140621782 16:76743301-76743323 TTGAATATGAGCTAAAGGGATGG - Intergenic
1140791094 16:78391913-78391935 TTAACTATGAGAAAGAGGGAGGG - Intronic
1140922885 16:79555021-79555043 TTGATTAAGAGGAGATGGGATGG + Intergenic
1144178786 17:12732914-12732936 TTGCTTTTGAGGAACAAAGAAGG - Intronic
1144649083 17:16996190-16996212 GTGCTTATGAAAAACAGGGATGG - Intergenic
1145801405 17:27688275-27688297 TTGATACTGAGGGAGAGGGATGG + Intergenic
1147952529 17:44115070-44115092 TTCACTGTGAGGACCAGGGATGG + Intronic
1148509538 17:48156981-48157003 TTTATTATTAGTAAAAGGGAAGG + Intronic
1149082409 17:52674897-52674919 TGACTTATGAGGAACAGCGAAGG - Intergenic
1149371178 17:55994603-55994625 TTAATTTTGAGACACAGGGAGGG + Intergenic
1151216086 17:72577312-72577334 TTGATTACTTGGAGCAGGGAGGG - Intergenic
1151957124 17:77386003-77386025 TTCCTGATGAGGAACAGGAAGGG - Intronic
1154404707 18:14078797-14078819 TTGATTATGAGAAACAAAGATGG + Intronic
1155802469 18:30125805-30125827 TTGGTTTTGAGGAACAGAGAAGG - Intergenic
1155899451 18:31370140-31370162 TTGGTTGTGATGAACATGGATGG + Intergenic
1158025460 18:52891710-52891732 ATGTTTATGAGGAAAAGGGATGG - Intronic
1158826132 18:61222255-61222277 TTTATTAAGAGGAAAAGGGAAGG - Intergenic
1159776595 18:72609696-72609718 GTGATTAGGAGTGACAGGGATGG - Intronic
1160874976 19:1292705-1292727 TTTATTCTGAGGATCAGGAATGG + Intronic
1161663583 19:5561555-5561577 TCCTTTAAGAGGAACAGGGATGG + Intergenic
1161803356 19:6427891-6427913 CTGATTAAGAATAACAGGGAAGG + Intronic
1165143202 19:33715037-33715059 GTGATCTTGAGGAACAGGAATGG - Intronic
1166134106 19:40765070-40765092 TTGACAATGAGGTACAGGCAGGG + Exonic
1168178230 19:54641448-54641470 TTCATCTTGAGGAACGGGGAGGG - Intronic
925818556 2:7777117-7777139 TTGTTTAGGAGGAAAAGTGACGG + Intergenic
927325080 2:21795689-21795711 TTGATTTGGAGAATCAGGGAAGG - Intergenic
927736692 2:25530061-25530083 ATAATTATGAAAAACAGGGATGG + Intronic
928988974 2:37210740-37210762 TTGTTTTTGGGGAACAGGTAGGG - Intronic
929532312 2:42760961-42760983 GTTATTATGTGGAGCAGGGAAGG - Intergenic
932259616 2:70316098-70316120 GTGATTCTGAAGAACAGTGAAGG - Intergenic
932400100 2:71474485-71474507 TTAATAATCAGGAACAGGGCAGG + Intronic
934505111 2:94884338-94884360 TTGAAAATGAGGAACAGTGTAGG - Intergenic
935783679 2:106530314-106530336 TAAATTTTGAGGAACAGGGAGGG + Intergenic
936240361 2:110783021-110783043 TTAATAATGAGGAGCAGGGAGGG + Intronic
939691175 2:145262777-145262799 ATGATTATGTTGAACAGTGATGG - Intergenic
940180316 2:150924382-150924404 TTGGTTGTGATGAGCAGGGATGG - Intergenic
940419459 2:153462643-153462665 TTGATTCTAAACAACAGGGAAGG - Intergenic
942200893 2:173569956-173569978 CTGATTATGAGGCACACGGTAGG - Intergenic
943904368 2:193478746-193478768 TACATTATGAGGATCAGGGGAGG + Intergenic
945627699 2:212231575-212231597 TTTATTCTGAAGAAGAGGGATGG + Intronic
1169070090 20:2721030-2721052 TTGATTATGATGTACATTGATGG + Intronic
1172173557 20:32959241-32959263 GAGAGTATTAGGAACAGGGATGG + Intronic
1172337436 20:34129000-34129022 TAGATTGTGAGGAAGAGGCAGGG + Intergenic
1173436101 20:43033536-43033558 TTTATTATGAGAAACCAGGAAGG - Intronic
1173796373 20:45863406-45863428 CTGATTGTCAGGAACAGGGTGGG + Intronic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1178555263 21:33585029-33585051 TTTATCATGAGGAATAGGGGTGG + Intronic
1179453479 21:41481451-41481473 TTGCTTATGAGTAGGAGGGACGG + Intronic
1183065822 22:35362065-35362087 TTCACTTTGGGGAACAGGGAAGG - Intergenic
1183862148 22:40678110-40678132 GTGATTCTGAAGAACAGGGTTGG - Intergenic
950796943 3:15517841-15517863 TTCATTATGATGAACATGAATGG - Intronic
950903055 3:16513952-16513974 TTGATTAGGAGGGGCTGGGAGGG - Intronic
951364321 3:21762282-21762304 TTGATTATGAAGCAAAGAGAAGG - Intronic
951385354 3:22035284-22035306 TAAATTATGAGAAACAGGGCTGG + Intronic
951605151 3:24424626-24424648 TAGATATTGAGGAACAGTGAAGG - Intronic
956724310 3:72144746-72144768 TTGAGGAGGAGGAAAAGGGAAGG - Intergenic
957119756 3:76074581-76074603 TTGATTATGAGTAAAAAGAAAGG + Intronic
958626216 3:96627320-96627342 TAGATTAGGGGGAGCAGGGAGGG + Intergenic
958712219 3:97731185-97731207 TTAATTTTGAGCAACAGGAAAGG + Intronic
959827186 3:110812405-110812427 TTGGAGATGAGGAGCAGGGAGGG - Intergenic
960256991 3:115521049-115521071 TTTATAATGAGAAAAAGGGAAGG - Intergenic
961111912 3:124291569-124291591 TAGATTGTGAGGAACATGTAAGG + Intronic
964450882 3:156811775-156811797 TTCAGTAAGAGAAACAGGGAGGG + Intergenic
964792045 3:160461427-160461449 CTGATTATGATGAACATGAAAGG - Intronic
965476355 3:169160143-169160165 TTGCTTCTGAGAAACAGAGATGG + Intronic
967903146 3:194477570-194477592 CTGATTAAGAGGAAGAGGAAGGG - Intronic
968263943 3:197347980-197348002 TTGATTATGAACACCAGGAAAGG - Intergenic
969761510 4:9187686-9187708 TTGCTGAGGAGGAAGAGGGAAGG - Intergenic
970178038 4:13359056-13359078 TTGAAGATGAGGAACAGAAAAGG - Intergenic
976709029 4:88049530-88049552 TTGTTTATAAAGAACAAGGAAGG + Intronic
977030007 4:91871357-91871379 TTGATAATGGGGAAAAGAGATGG + Intergenic
978361427 4:107934308-107934330 TTGATTAGAAGGGACTGGGAAGG - Intronic
981361212 4:143847827-143847849 TAGATTATGAGGACCTAGGAAGG + Intergenic
981450579 4:144892711-144892733 TTGGTTACCAGGGACAGGGAGGG - Intergenic
982140451 4:152312591-152312613 TTCATAATGATGAACATGGATGG + Intergenic
982222563 4:153137535-153137557 TTCAATATGAGAAAGAGGGAAGG + Intergenic
982408655 4:155047682-155047704 TTGACTATCAGGAAGTGGGAGGG + Intergenic
983203599 4:164888321-164888343 TTCATTGTGAGAAACAGAGAAGG + Intronic
983780764 4:171667367-171667389 AAGTTTATGAGGAACAGGTATGG + Intergenic
984116406 4:175686470-175686492 TTCCTTATGAGATACAGGGAGGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984855390 4:184190721-184190743 TTGGTTATGGGGACCTGGGAGGG - Intronic
985439624 4:189971114-189971136 TGGAATGGGAGGAACAGGGAAGG - Intergenic
988385449 5:30558666-30558688 ATGATTCTGACCAACAGGGATGG + Intergenic
988460940 5:31437412-31437434 TTAATTATGAGGAATAGGGAAGG - Intronic
988997026 5:36724620-36724642 TTGAAAATAAGGAAGAGGGAGGG + Intergenic
991658415 5:68926415-68926437 TTGTTTCAGAGGAAAAGGGAAGG + Intergenic
992157965 5:73973279-73973301 TTTATTATGAGGTCCCGGGAAGG - Intergenic
992639929 5:78760520-78760542 ATGATAATGAGGAAGAGGAAAGG - Intronic
993153561 5:84192356-84192378 TTCATTATCATGAACAGGGGAGG - Intronic
993371968 5:87103598-87103620 CTGATTAGGAGGCACTGGGATGG - Intergenic
994048230 5:95332702-95332724 TTGTTTATGAAGTATAGGGATGG - Intergenic
996361449 5:122652068-122652090 TTGATTATTAGGAACTGGGAGGG - Intergenic
996394830 5:123003084-123003106 TTTATTGTCAGAAACAGGGAGGG - Intronic
996790368 5:127287213-127287235 TTTATGATGAGCAACAAGGATGG + Intergenic
997508306 5:134435547-134435569 TGGAGTATGTGGAACTGGGAAGG + Intergenic
997865941 5:137462866-137462888 TTCACTAGAAGGAACAGGGAGGG + Intronic
998156551 5:139790024-139790046 GTGCTTTGGAGGAACAGGGAGGG + Intergenic
998818890 5:146040761-146040783 TTGCTCATCAAGAACAGGGAGGG + Intronic
999327600 5:150652740-150652762 TAGATAATGGGGAGCAGGGAGGG - Exonic
999718699 5:154382427-154382449 TTGATTCTGAGGTACACAGAAGG - Intronic
1002507816 5:179692373-179692395 TTGGTTATAAGGAACACAGATGG - Intronic
1004319058 6:14618329-14618351 TGGATTATGGGGGACACGGATGG + Intergenic
1004785991 6:18967926-18967948 TTGATAATGTGGAAGAGAGAGGG + Intergenic
1004875246 6:19944749-19944771 TTGGTTTTGAGGAAAAGGGGTGG - Intergenic
1006187804 6:32190564-32190586 TTAATTAAGTAGAACAGGGAGGG - Intergenic
1006208194 6:32369028-32369050 TTGAGGATGGGAAACAGGGAGGG + Intronic
1007262938 6:40576546-40576568 TGGATCATGAGTTACAGGGAAGG - Intronic
1007628385 6:43259337-43259359 GTGCTTAGGAGGAACAGGGCAGG - Intronic
1011068452 6:83355866-83355888 TTGATCAAGAATAACAGGGATGG - Intronic
1011525716 6:88262501-88262523 TTGATTATAAGGAATGGGGAAGG - Intergenic
1013780538 6:113724051-113724073 TTAATTAAGAGGAAAAGGGCCGG + Intergenic
1013954619 6:115826591-115826613 GTTATTCTGAGGAACAGAGAAGG + Intergenic
1014957044 6:127633101-127633123 TTGATTTTCAGGAAGAGAGATGG - Intergenic
1015590325 6:134816840-134816862 TTGATTTGGAGGATCAGGGGAGG - Intergenic
1016543910 6:145198694-145198716 TTGAATATGGTGAACAGGTAAGG + Intergenic
1016612461 6:146006903-146006925 ATGATTATCAGAAACTGGGAAGG + Intergenic
1016630147 6:146219966-146219988 CTTAGTATTAGGAACAGGGAAGG + Intronic
1018666227 6:166140960-166140982 GTGGTGGTGAGGAACAGGGATGG - Intergenic
1018903202 6:168061365-168061387 GTGAGGATGTGGAACAGGGAGGG + Intronic
1019856606 7:3614803-3614825 TTCATTATAAGGAGAAGGGAAGG - Intronic
1019959299 7:4445266-4445288 TGGGTTATGAGGAAAAGAGAGGG + Intergenic
1020189074 7:5980782-5980804 TCTATTAAGAGGAACAGGGAAGG + Intronic
1020293842 7:6743971-6743993 TCTATTAAGAGGAACAGGGAAGG - Intergenic
1021156035 7:17211057-17211079 TTAATTATGAAGAGCAGGGAGGG - Intergenic
1022128130 7:27377677-27377699 TTGATTAAGAGAAATTGGGATGG + Intergenic
1022290663 7:28999590-28999612 TTGATAATTATGGACAGGGAAGG - Intronic
1023112870 7:36831674-36831696 TTGTTGAAGAGGAACAGGGCAGG + Intergenic
1024827997 7:53415227-53415249 TTGAATATGAGGAATATAGAAGG - Intergenic
1025921723 7:65919703-65919725 TAGACTATGAGGAAGAAGGATGG - Intronic
1028735897 7:94211647-94211669 TTTTTTATGAGGAAAAGGAAAGG + Intergenic
1028804757 7:95012293-95012315 CAGAATAGGAGGAACAGGGAGGG + Intronic
1029005661 7:97206643-97206665 TTCTTTATGAGGAATAGGCAAGG - Intergenic
1029439671 7:100580040-100580062 TTGGTTTTGAAGAACAAGGAGGG - Intronic
1029935338 7:104418749-104418771 GTGATTCTGAAGAACAGAGATGG + Intronic
1033118980 7:138650285-138650307 TTGGGGATGAGGGACAGGGAGGG + Intronic
1034991065 7:155548486-155548508 GAGATTAGGAGGAAGAGGGATGG + Intergenic
1036271611 8:7309515-7309537 TTGCTGAGGAGGAAGAGGGAAGG - Intergenic
1036296471 8:7541988-7542010 TTGATGATGGGGAACAGCAAAGG - Exonic
1036326095 8:7779031-7779053 TTGATGATGGGGAACAGCAAAGG + Exonic
1036349737 8:8000835-8000857 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1036391592 8:8328670-8328692 CTGAGTATGAGGGACAGGGTAGG - Intronic
1036845011 8:12161356-12161378 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1036866380 8:12403677-12403699 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1037095384 8:14980262-14980284 TTGATCACGAAGAACAGAGACGG + Intronic
1038980694 8:32756275-32756297 CTGGTGATGAGGAAGAGGGAAGG - Intronic
1040829238 8:51659515-51659537 TTGAGGATGAAGAAAAGGGATGG + Intronic
1040896955 8:52378091-52378113 GTGATTATCAGAGACAGGGAGGG + Intronic
1042506464 8:69565958-69565980 TGGGTTATGAAGAACAGGTAGGG - Intronic
1042782146 8:72503535-72503557 TTTACTGTGAAGAACAGGGAAGG - Intergenic
1042791112 8:72607245-72607267 TGGAGTTGGAGGAACAGGGATGG + Intronic
1043277012 8:78410716-78410738 TTGCTTATGCGGATCAGGAAAGG - Intergenic
1043651429 8:82597819-82597841 TTGTTTTTCAGGAAGAGGGAAGG - Intergenic
1044055425 8:87563941-87563963 TTGGTTACTAGGCACAGGGAAGG - Intronic
1045374004 8:101553146-101553168 TTGCTTTTGATGATCAGGGAAGG + Intronic
1045550057 8:103163493-103163515 ATGATTCTGATGAACAGAGAGGG - Intronic
1046248953 8:111604715-111604737 TTGAAGAAGAGGATCAGGGAGGG - Intergenic
1048307578 8:133294982-133295004 TGGAAAATGAGGCACAGGGATGG - Intronic
1049035721 8:140074421-140074443 TTGGAGATGAGGAAGAGGGACGG - Intronic
1053093595 9:35303918-35303940 TTGGTTATGAGTACCAGGAATGG + Intronic
1053300692 9:36947205-36947227 TGGAGTATGAGGATCAGTGATGG - Intronic
1054709942 9:68501168-68501190 TTGCTTCTGAGGAGAAGGGAGGG - Intronic
1054798161 9:69321731-69321753 TGGAAAATGAGGGACAGGGAGGG + Intergenic
1054935904 9:70687253-70687275 TTGAGGATGAGGAGCAGGAAGGG + Intronic
1058196299 9:101980620-101980642 TTGATTCAGAGAAACAGGTAAGG - Intergenic
1058785025 9:108378544-108378566 TTTATGATCAGGTACAGGGATGG + Intergenic
1058838157 9:108878091-108878113 TTGAGTTTGATGAACAAGGAAGG - Exonic
1058922437 9:109629845-109629867 TTGAATGTGAGGCACAGAGAAGG - Intergenic
1059903588 9:118956202-118956224 TTGACTATGGGGAAAAGAGAGGG + Intergenic
1060547275 9:124468882-124468904 AGGATTATGAGGAATGGGGATGG - Intronic
1061861992 9:133472896-133472918 TTCATTATAAGAAACAGGAACGG - Intronic
1062235525 9:135506008-135506030 GTGACCATGAGGAGCAGGGAGGG + Intergenic
1189161792 X:38816798-38816820 TTAAATATGAGGGCCAGGGAAGG + Intergenic
1189328778 X:40130148-40130170 TAGATGAAGAGGGACAGGGAAGG - Intronic
1189605862 X:42677013-42677035 TTGGTTCTAAAGAACAGGGAAGG - Intergenic
1190851371 X:54245733-54245755 TTGATTATTGGTAACAGGAAAGG - Intronic
1194489435 X:94528293-94528315 GTGATTATTAGAAACAGGGATGG - Intergenic
1195550767 X:106167523-106167545 GTGAATATCAGGAATAGGGAAGG + Intergenic
1198084734 X:133271246-133271268 TTGATAATGAGAAGCAGGAAGGG + Intergenic
1199220906 X:145314680-145314702 TTGATTTGGAGGAAGAGGGTGGG - Intergenic
1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG + Intronic