ID: 1200302772

View in Genome Browser
Species Human (GRCh38)
Location X:154995201-154995223
Sequence CAACGTGAGCCTTGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200302772_1200302780 -10 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302780 X:154995214-154995236 GCTCACGTTGTGGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 40
4: 292
1200302772_1200302782 -8 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302782 X:154995216-154995238 TCACGTTGTGGTGGGGGCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 357
1200302772_1200302781 -9 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302781 X:154995215-154995237 CTCACGTTGTGGTGGGGGCAGGG 0: 1
1: 0
2: 1
3: 37
4: 340
1200302772_1200302783 -5 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302783 X:154995219-154995241 CGTTGTGGTGGGGGCAGGGGCGG 0: 1
1: 0
2: 12
3: 140
4: 1246
1200302772_1200302787 23 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302787 X:154995247-154995269 CATGTTGGAGGTTCAATGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1200302772_1200302785 8 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302785 X:154995232-154995254 GCAGGGGCGGGAGCACATGTTGG 0: 1
1: 0
2: 2
3: 16
4: 236
1200302772_1200302784 -4 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302784 X:154995220-154995242 GTTGTGGTGGGGGCAGGGGCGGG 0: 1
1: 0
2: 30
3: 262
4: 1967
1200302772_1200302786 11 Left 1200302772 X:154995201-154995223 CCTTTTTCCCAAGGCTCACGTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1200302786 X:154995235-154995257 GGGGCGGGAGCACATGTTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200302772 Original CRISPR CAACGTGAGCCTTGGGAAAA AGG (reversed) Intronic
900946566 1:5834338-5834360 GAATGTGAGACTTGGGACAAAGG - Intergenic
903502349 1:23808094-23808116 CACCGTGACCTTTGGGAGAATGG + Intronic
906120245 1:43384962-43384984 CTAGGTGAGCCTTGAGCAAAAGG + Intronic
906856139 1:49307191-49307213 CTATGTGAGCCTTTGGAAAAGGG - Intronic
909247236 1:73301747-73301769 GAATGTGAGACTTGGAAAAAGGG - Intergenic
909515803 1:76505838-76505860 CAACGTGTGCATGGGGAAAGTGG + Intronic
911896672 1:103444588-103444610 CAAGGTCAGCCTTGGCAACATGG + Intergenic
912148854 1:106831265-106831287 CAATGTGATCCTTTGGAGAAGGG - Intergenic
913219730 1:116649727-116649749 GAAAGTGGGCCTTGGGAAGAAGG - Intronic
916585915 1:166149999-166150021 CAAAGTGAGCCTTGGGGGTAAGG + Intronic
916589440 1:166176177-166176199 CAAAGTGGGCCTTGGGAACAAGG - Intergenic
916631406 1:166618188-166618210 CACAGTGAGCCTTGGGAGATGGG + Intergenic
918632304 1:186732324-186732346 CACCGTGAGCCTATGGAGAAAGG + Intergenic
1063904293 10:10766614-10766636 CTAGGTGAGCCTTGGGGAGAGGG + Intergenic
1067305086 10:45056361-45056383 CAAGGTAAGCCTTCTGAAAATGG + Intergenic
1067384693 10:45807964-45807986 CAACAGGAGACTTGGGAAAAAGG - Intergenic
1068670606 10:59718792-59718814 GAACCTGAGTCTTAGGAAAAGGG + Intronic
1069798278 10:71067017-71067039 CAAAGGGAGCCTTTGGAACAGGG + Intergenic
1072276698 10:93830239-93830261 CACCTTTAGCCTGGGGAAAAGGG - Intergenic
1075868833 10:125752526-125752548 GAACAGGAGCCTTAGGAAAAGGG - Intronic
1076802081 10:132835497-132835519 CATGGTGAGCACTGGGAAAAGGG + Intronic
1078341711 11:10501986-10502008 CAACAACAGCCTTTGGAAAAAGG - Intronic
1079008060 11:16806528-16806550 CATCGTGAGCCCTGAGAAAGTGG - Intronic
1079316328 11:19410811-19410833 CAAGCTGAGCCTTGAGAATAGGG - Intronic
1085449888 11:76625413-76625435 GGACATGAGGCTTGGGAAAAAGG - Intergenic
1087959893 11:104334900-104334922 CAAAATTAGCCTTGGGATAAAGG + Intergenic
1095376034 12:41530178-41530200 AAACGTGAGCGTTGGGTAGACGG - Intronic
1096296712 12:50390247-50390269 CAGAGTGTGCATTGGGAAAAAGG - Intronic
1096614844 12:52826311-52826333 CAAGGCTAGCCTGGGGAAAATGG + Intronic
1096649213 12:53053696-53053718 CAATGTGGGCCTTGGGGACAGGG - Intronic
1101778672 12:107816451-107816473 CCAGGTCAGCCTTGGGAAGAGGG - Intergenic
1103485527 12:121280091-121280113 CAATGTCCTCCTTGGGAAAATGG + Intronic
1103485726 12:121281432-121281454 CAATGTCCTCCTTGGGAAAATGG + Intronic
1104961825 12:132491698-132491720 GAAGCTGAGCTTTGGGAAAAGGG + Intronic
1109030727 13:57184378-57184400 CAAACTGAAGCTTGGGAAAAAGG + Intergenic
1109476691 13:62887748-62887770 CAAAGTGAGCCTTTGGAGATGGG + Intergenic
1109763341 13:66860369-66860391 CAAGCTGAACCTTGGGACAAGGG - Intronic
1111139525 13:84097474-84097496 CAAGGTGAGCCTGGGCAACATGG - Intergenic
1111748717 13:92299910-92299932 CAGCCTGAGGCTTGTGAAAAAGG + Intronic
1111949096 13:94695903-94695925 TAATGTGAGTCTAGGGAAAAAGG + Intergenic
1113296174 13:108961152-108961174 CAACGTGAGCCTGGAGAGGAGGG + Intronic
1114802855 14:25797976-25797998 CTATGTCAGCCTTGGGAAGAGGG - Intergenic
1116310822 14:43324726-43324748 CAAAGTCTGCCTTGGGAAATTGG - Intergenic
1122588376 14:102826911-102826933 CACCATGTGCCTTGGGCAAATGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123875769 15:24622269-24622291 CACGGTGAGCCTTGGGTAATGGG + Intergenic
1127734092 15:61825854-61825876 CAGCTTAAGTCTTGGGAAAATGG + Intergenic
1127978123 15:64014106-64014128 GAACCTGATCCTTGGGAAATGGG + Intronic
1128157768 15:65402478-65402500 CACGATGAGCCTTGGGAAGAGGG + Exonic
1130114866 15:80997970-80997992 CAAGGTGAGCCTTTGGGAGATGG - Intergenic
1132764346 16:1526714-1526736 CAAGGTGTGCCTGGGGAACATGG - Exonic
1133144683 16:3775878-3775900 GAAATTGAGCCTTGGGAAAGTGG - Intronic
1133811798 16:9166425-9166447 CAAGGTCAGCCTGGGCAAAATGG + Intergenic
1133849765 16:9491518-9491540 CAATGTGAGCCTAGGGTCAAGGG - Intergenic
1134756422 16:16671506-16671528 CAATTTGAGCATTGGTAAAAAGG + Intergenic
1134989647 16:18687657-18687679 CAATTTGAGCATTGGTAAAAAGG - Intergenic
1135251878 16:20907323-20907345 CAACAAGAGCCTTTGGGAAAGGG - Intronic
1136651253 16:31673502-31673524 CATGGTGAGCCTTGGGTGAAGGG + Intergenic
1138633439 16:58317676-58317698 CAAGGGGATCCTTGGAAAAATGG - Intronic
1139840329 16:69873445-69873467 CACCCTGAGCCTTGGGGAAGAGG + Intronic
1140143982 16:72287512-72287534 CAACGTGAGACTGGAGAAACAGG + Intergenic
1141664609 16:85459465-85459487 CAACAAGAGCCCAGGGAAAAGGG - Intergenic
1141751770 16:85962902-85962924 CAAGTTCAGTCTTGGGAAAATGG + Intergenic
1144490960 17:15708626-15708648 TAAGGTGACCCTTGGGAGAAGGG - Intronic
1148468516 17:47878893-47878915 CAACCCGAGCCTGGGGAAAAGGG + Intergenic
1148497112 17:48059634-48059656 GAAAGTGAGCCTGGGGAAGAAGG + Exonic
1151375682 17:73687214-73687236 CAACGTGAGATTTGGTAAGAGGG - Intergenic
1151498667 17:74474789-74474811 CAACCTGGGCCTGGGGCAAAGGG - Intronic
1153322234 18:3784714-3784736 GAGCGAGAGCCTTGGGGAAAAGG + Intronic
1153616663 18:6941198-6941220 TCAAGTGAGCCTTTGGAAAATGG + Intergenic
1156690352 18:39700137-39700159 CAATGTGAGCCTTGGGAAGCAGG - Intergenic
1159693406 18:71521565-71521587 GAAGATGAGCCTTGAGAAAATGG - Intergenic
1159726998 18:71973644-71973666 CAATGAGAATCTTGGGAAAAAGG + Intergenic
1160078414 18:75700503-75700525 CAATGTGATCCCTGGGCAAATGG + Intergenic
1160451810 18:78971608-78971630 CAATGGGAGCCTTGGGGAAGAGG - Intergenic
1161352748 19:3803093-3803115 CACCTTGAGCCCTGGGCAAATGG + Intergenic
1168719227 19:58545626-58545648 CACCCAGAGCCTTGGGAAAGTGG - Intronic
925776983 2:7345492-7345514 CAAAGTGAGGCTGGGGAAATAGG + Intergenic
929556276 2:42927506-42927528 CAAGGGGACCCTTGGCAAAACGG - Intergenic
936441489 2:112557784-112557806 CAACATGAGACTGGGCAAAATGG - Intronic
937111744 2:119371946-119371968 CATTGTGAGCCTTGGGAGAGAGG - Intronic
940624383 2:156154110-156154132 CTATGTGAGGCTGGGGAAAATGG + Intergenic
940803413 2:158157499-158157521 CAAAGTAAGCCTTGGGCAAGTGG - Intergenic
943705450 2:191028950-191028972 CAACCTGAGACTGGGGAAAGAGG - Intergenic
1169550692 20:6698370-6698392 CAGGGTCAGCCTAGGGAAAAAGG + Intergenic
1170577098 20:17672377-17672399 AAAGGTGGGCCTTGGGAAAAGGG - Intronic
1171210446 20:23312509-23312531 CAAAATGATCCTTGGAAAAAAGG + Intergenic
1172563017 20:35906163-35906185 CAAAGTGAGCCTTGGGGCACTGG + Intronic
1173353875 20:42269087-42269109 CTACCTGAGCCCTGGGTAAAGGG - Intronic
1174614942 20:51828509-51828531 CAACGTCAGGGCTGGGAAAAGGG + Intergenic
1175804590 20:61820495-61820517 CAGAGTGACCCTTGGGCAAATGG - Intronic
1177458354 21:21374563-21374585 CCACGTGAGTTTTGGGAAATGGG + Intronic
1178117397 21:29431503-29431525 AAAAGTGGGCCGTGGGAAAAGGG - Intronic
1180168743 21:46046332-46046354 CAAGGTGAGCCTGGGCAACATGG + Intergenic
1180821018 22:18827768-18827790 GAAAGTGGGCCTTGGGAAGAAGG - Intergenic
1181191959 22:21148277-21148299 GAAAGTGGGCCTTGGGAAGAAGG + Intergenic
1181207238 22:21262233-21262255 GAAAGTGGGCCTTGGGAAGAAGG - Intergenic
1181862013 22:25826397-25826419 CATCTTGAGCCCTGGGAAAGAGG - Exonic
1184237212 22:43189313-43189335 CAAAGTGAGCATGGGGAGAAAGG - Intergenic
1184969667 22:48006885-48006907 CAGCGTGTGCTTAGGGAAAATGG + Intergenic
1203219682 22_KI270731v1_random:33183-33205 GAAAGTGGGCCTTGGGAAGAAGG + Intergenic
1203271145 22_KI270734v1_random:53644-53666 GAAAGTGGGCCTTGGGAAGAAGG - Intergenic
952542933 3:34386975-34386997 CATCATGAGCAATGGGAAAAAGG - Intergenic
952875586 3:37941755-37941777 CGGGCTGAGCCTTGGGAAAATGG + Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
960847927 3:122022001-122022023 GCAGGTGAGCCTTGGAAAAATGG - Exonic
962001783 3:131305540-131305562 CATGGTGAGCCTTGGGGAATTGG + Intronic
967913539 3:194561122-194561144 AAACGTGTGCCTGGAGAAAACGG + Intergenic
969164114 4:5290169-5290191 CAAGGTGAGCCTTGGAAGATGGG - Intronic
975503790 4:75116553-75116575 CAATGTGAGCACTTGGAAAAGGG + Intergenic
976075243 4:81290717-81290739 CTATGTGAGCCATGGGAAACAGG - Intergenic
976284629 4:83359619-83359641 CAATGTGAGCTTTGGGCAAGAGG - Intergenic
976963261 4:91004254-91004276 TAAGATGAGACTTGGGAAAAGGG - Intronic
979692368 4:123573645-123573667 CACAGTGATCCATGGGAAAACGG - Intergenic
979973075 4:127161719-127161741 AAACCTTAGCCTTGGAAAAAGGG + Intergenic
980532267 4:134070950-134070972 CATGGCGAGCCTTGGGAAATGGG + Intergenic
984144533 4:176044631-176044653 CAAATTGAGCCTAGGGAAATGGG + Intergenic
984863109 4:184257288-184257310 CATAGTGAGACTTGAGAAAAAGG + Intergenic
985419701 4:189772483-189772505 CAACATGATGCCTGGGAAAACGG - Intergenic
988287141 5:29234812-29234834 CAACATGATCCATGGGAAAATGG + Intergenic
988686842 5:33533837-33533859 CAACAGGAGCTTTGGGAAAGAGG - Intronic
989529220 5:42487371-42487393 TAACGTAAGCGTTGGCAAAAAGG + Intronic
991028129 5:62052541-62052563 CAAAGTGAGCCTTGGGGGATGGG + Intergenic
995875975 5:116790352-116790374 CAACGTAAGGCTTGGAAATAAGG - Intergenic
996217979 5:120892126-120892148 CAAAGTGACCCTTAGGACAAAGG - Intergenic
998659573 5:144220989-144221011 CAACTTGAACCTTGAGAAAGAGG + Intronic
1001680204 5:173551134-173551156 CAACTAGAGCCTTGGAAAGAGGG + Intergenic
1002824146 6:757503-757525 CTATGTGACCCTTGGGATAAAGG + Intergenic
1003673310 6:8180061-8180083 CAAATAGAGCCTTTGGAAAAGGG + Intergenic
1005977794 6:30813504-30813526 CAACATCAGCCTTGGAAAAAAGG - Intergenic
1007936980 6:45741165-45741187 CAACATGAGCCAAGGCAAAAAGG - Intergenic
1012374796 6:98548410-98548432 TAACATGAGCTCTGGGAAAAAGG - Intergenic
1012490808 6:99780569-99780591 CAAGTTGAGCCTTGGGGAATGGG + Intergenic
1013470645 6:110460885-110460907 CAAAGTGCTCCTTGGGACAAAGG + Intronic
1019133110 6:169891624-169891646 CACCGTGAGCCTCGTGAACAGGG + Intergenic
1019133149 6:169891924-169891946 CACCGTGAGCCTTGTGGAGAAGG + Intergenic
1019133168 6:169892044-169892066 CACCGTGAGCCTTGTGGAGAGGG + Intergenic
1019133178 6:169892104-169892126 CACCGTGAGCCTTGTGGAGAAGG + Intergenic
1019215918 6:170443696-170443718 CAACGTGTGCTTGGGGAACACGG + Intergenic
1024879168 7:54066500-54066522 CATCAAGAGCCTTGGGAAATGGG - Intergenic
1027404919 7:77850148-77850170 CAATGTCAGCCTGGGGAACATGG + Intronic
1028907978 7:96176029-96176051 AAACATGAGTCTTGGGTAAATGG + Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1038170633 8:25128552-25128574 CAAGTTGAGCTTTGGGAAATGGG - Intergenic
1039057791 8:33550458-33550480 GAACAGGAGCCTTGGGAAATGGG + Intronic
1039351944 8:36772803-36772825 CAAGGTGAGCCTGGGGACAGTGG - Intergenic
1039590463 8:38742257-38742279 GAAAGTGAGCCTTAGGCAAAAGG + Intronic
1043763546 8:84100119-84100141 CACCCTAAGCCTTGGGAACAGGG - Intergenic
1048954617 8:139525693-139525715 GGACTTGAGCCTGGGGAAAAAGG - Intergenic
1050367439 9:4885498-4885520 TCACGTGAGACTTGGGAAAGTGG - Intronic
1052311165 9:27070889-27070911 TAACGTTAGCTGTGGGAAAAGGG + Intergenic
1059063144 9:111054282-111054304 CGACGTGGATCTTGGGAAAAAGG - Intergenic
1060461306 9:123857141-123857163 CAAAAGGAACCTTGGGAAAATGG + Intronic
1185582021 X:1217100-1217122 CATGGTGAGCGCTGGGAAAAGGG + Intergenic
1185784357 X:2877325-2877347 CACCGGGAGCCTTGGGCAAGGGG - Intronic
1188771405 X:34158351-34158373 CAAGTTGAGCCTAGGGAAATGGG + Intergenic
1193165569 X:78276783-78276805 CAAATTGATCCTTGGAAAAAAGG + Intronic
1193215452 X:78858271-78858293 CTACGTGGGCATTGAGAAAATGG - Intergenic
1200302772 X:154995201-154995223 CAACGTGAGCCTTGGGAAAAAGG - Intronic
1202345085 Y:23913845-23913867 CAACACAAGCCTTGGCAAAATGG + Intergenic
1202525685 Y:25756239-25756261 CAACACAAGCCTTGGCAAAATGG - Intergenic