ID: 1200316382

View in Genome Browser
Species Human (GRCh38)
Location X:155137125-155137147
Sequence GCTCATCGGTGGTCGCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200316382_1200316396 26 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316396 X:155137174-155137196 GGTGAGTAGGAGGCCGGGTATGG 0: 1
1: 1
2: 2
3: 28
4: 294
1200316382_1200316394 20 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316394 X:155137168-155137190 CTGGCTGGTGAGTAGGAGGCCGG 0: 1
1: 0
2: 1
3: 51
4: 401
1200316382_1200316393 16 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316393 X:155137164-155137186 GAAACTGGCTGGTGAGTAGGAGG 0: 1
1: 0
2: 3
3: 21
4: 275
1200316382_1200316391 13 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316391 X:155137161-155137183 GCCGAAACTGGCTGGTGAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1200316382_1200316397 27 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316397 X:155137175-155137197 GTGAGTAGGAGGCCGGGTATGGG 0: 1
1: 0
2: 1
3: 12
4: 109
1200316382_1200316395 21 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316395 X:155137169-155137191 TGGCTGGTGAGTAGGAGGCCGGG 0: 1
1: 0
2: 3
3: 35
4: 372
1200316382_1200316389 5 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316389 X:155137153-155137175 GAGCCTGAGCCGAAACTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 142
1200316382_1200316388 1 Left 1200316382 X:155137125-155137147 CCTCGGGGCGACCACCGATGAGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200316388 X:155137149-155137171 CATGGAGCCTGAGCCGAAACTGG 0: 1
1: 1
2: 12
3: 131
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200316382 Original CRISPR GCTCATCGGTGGTCGCCCCG AGG (reversed) Intronic
900606137 1:3524351-3524373 GCTCATGGGTGGTGCCCTCGAGG - Intronic
909502735 1:76353752-76353774 GCTCATGGGTGGCAGCCCTGGGG - Intronic
912964960 1:114229388-114229410 GCTCATCGGTGGTTGAACTGTGG - Intergenic
1072621684 10:97083953-97083975 GCTCCTGGGTGGTGGCCCAGAGG - Intronic
1075589347 10:123680086-123680108 GCTCAGTGGTGGTGGCCCAGGGG + Intronic
1077238738 11:1499476-1499498 GCTCATCCGTGGTCATCCCGTGG - Intronic
1077238755 11:1499545-1499567 GCTCATCCGTGGTCATCCCATGG - Intronic
1077238770 11:1499614-1499636 GCTCATCTGTGGTCATCCCGTGG - Intronic
1091037558 11:132247161-132247183 GCTCATCATTGATCGCCCTGTGG + Intronic
1109750107 13:66680690-66680712 GCTCATTGGTTGTGGCCCCTGGG - Intronic
1150640879 17:66948619-66948641 GGTCATTTGTGGTGGCCCCGGGG - Intergenic
1152252408 17:79218909-79218931 GCTCACCGCTGGTCACCCCATGG - Intronic
1157411050 18:47463879-47463901 GCTCTTCTGTTGTCACCCCGTGG + Intergenic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1163775395 19:19214357-19214379 GCTCATCTCTGGCCGCCCTGGGG + Intronic
1166786530 19:45370456-45370478 GGTCATCGGTGGGCGCGCCTGGG - Intronic
1166817709 19:45556885-45556907 GCTGATCTGGGGTCCCCCCGGGG + Intronic
1167896245 19:52584875-52584897 CCTCCTCGGGGGTCTCCCCGCGG + Exonic
928199938 2:29241407-29241429 GCTCATGGGTGAAAGCCCCGGGG + Intronic
946248045 2:218398408-218398430 GCGCAATGGTGGCCGCCCCGTGG + Intronic
1174203446 20:48823203-48823225 GCTCCTCGAAGGTCTCCCCGTGG - Intronic
953881572 3:46693799-46693821 GCTCCTCGGTGGCCCGCCCGTGG - Intergenic
964041643 3:152268681-152268703 GGTCATGGGCGGTCGCCCAGCGG - Exonic
999132260 5:149293133-149293155 ACTCATCTGTGATCGCCCCATGG - Intronic
1006169749 6:32086080-32086102 GCTCATCGGTAGTCCCCAAGAGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1049083240 8:140458325-140458347 GCTCAGGGGTGGAGGCCCCGCGG + Exonic
1198678047 X:139152285-139152307 TCACATCGGTAATCGCCCCGGGG - Intronic
1200316382 X:155137125-155137147 GCTCATCGGTGGTCGCCCCGAGG - Intronic