ID: 1200316944

View in Genome Browser
Species Human (GRCh38)
Location X:155144311-155144333
Sequence GTGAACAATAGGTAGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200316940_1200316944 10 Left 1200316940 X:155144278-155144300 CCAAAATATATATGACATAAGTC 0: 1
1: 0
2: 2
3: 20
4: 329
Right 1200316944 X:155144311-155144333 GTGAACAATAGGTAGGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200316944 Original CRISPR GTGAACAATAGGTAGGTTTG TGG Intronic
905598525 1:39230160-39230182 GTGCTAAATAGGTATGTTTGGGG + Intronic
907237914 1:53063949-53063971 GTGATCAAAAGGTAGGGGTGGGG - Intronic
908831283 1:68180985-68181007 GTAGACAATAGGTAGGGTTGGGG + Intronic
913708770 1:121457003-121457025 GTGAAAACTGGGTAGGTATGGGG + Intergenic
917292991 1:173490543-173490565 AGGGACAATAGATAGGTTTGAGG - Intergenic
917413931 1:174788704-174788726 GTGTCCAATAGGTACATTTGAGG - Intronic
919136716 1:193518530-193518552 GTGACTAAGAGGAAGGTTTGTGG + Intergenic
919364927 1:196647452-196647474 GTGAAGAATAGGAAAGTGTGGGG - Intergenic
924078085 1:240362026-240362048 CTGAACAACAGCTAGGCTTGTGG + Intronic
1067894207 10:50162067-50162089 GTGAGCATTAGGCGGGTTTGTGG - Intergenic
1067954633 10:50778194-50778216 GTGAGCATTAGGCGGGTTTGTGG + Intronic
1068110638 10:52676178-52676200 CTGAGCAATAGGTAGTTTTGAGG + Intergenic
1068669194 10:59707413-59707435 GTTACCAGTAGGTAGGGTTGGGG + Intronic
1069882074 10:71599514-71599536 GTGAAAAATTGGTAGTGTTGTGG + Intronic
1072706153 10:97682531-97682553 GAGAACAAAAGGCAGGTTAGGGG - Intronic
1074918313 10:117980838-117980860 GTCCACCATAGGTTGGTTTGGGG - Intergenic
1080658938 11:34280358-34280380 GTTCCCAACAGGTAGGTTTGAGG + Intronic
1081388310 11:42499503-42499525 GAGAACAGTAAGTAGGTTTAGGG - Intergenic
1087339087 11:96879133-96879155 GTGACTAATAGCAAGGTTTGAGG + Intergenic
1087746408 11:101952662-101952684 GGGAAGAATAGATAGGTTTAGGG + Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089268474 11:117284131-117284153 TTGAACAATAGTTAGATATGTGG - Intronic
1093529921 12:20148483-20148505 GTGATTAATAGTTAGGTTTTGGG - Intergenic
1097183434 12:57183910-57183932 GTGAGCAGTGGGCAGGTTTGTGG + Intronic
1101838181 12:108309754-108309776 GGGAACAATAGGGAGGGGTGGGG - Intronic
1106209214 13:27625362-27625384 GAGAAGAGAAGGTAGGTTTGAGG + Intronic
1108108521 13:47041195-47041217 GTGTCCAATAGATGGGTTTGTGG - Intergenic
1112171171 13:96973579-96973601 GTGAACAATAAATAAGGTTGGGG - Intergenic
1112708151 13:102095926-102095948 ATGAACAACATGAAGGTTTGGGG - Intronic
1119517165 14:75257405-75257427 GTGAGTAATAGGTAGGTCAGAGG + Intronic
1121599992 14:95196198-95196220 CTGAACCATAGGTAGGCGTGGGG - Intronic
1124568908 15:30841935-30841957 GTACACAATAGGGAGGTCTGAGG + Intergenic
1125536697 15:40444846-40444868 GGGCACAAAAGGGAGGTTTGGGG - Intronic
1127761363 15:62142657-62142679 GTGAACAGGTGGTAGGATTGTGG + Intergenic
1131798769 15:96047894-96047916 CTGAACAATGGGAAAGTTTGAGG - Intergenic
1132835181 16:1949657-1949679 GTGACCCATAGGTATGTATGGGG + Intronic
1140127669 16:72131658-72131680 GAGAACAATGGGGAGGTTTGTGG + Intronic
1149727625 17:58912468-58912490 GTGCATAATTGGTATGTTTGAGG + Intronic
1163370977 19:16901149-16901171 CTGAACAATAGGTAGGGCTTAGG - Intronic
1164326971 19:24202395-24202417 GTGCACAATGTGCAGGTTTGTGG - Intergenic
1164475553 19:28573214-28573236 GAGAACAAGAGCCAGGTTTGAGG - Intergenic
1165531544 19:36406366-36406388 GTGACCAATAGGGATATTTGGGG - Intronic
931735249 2:65187859-65187881 GTGGACAAGAGGGAGGTTTTGGG - Intergenic
931896891 2:66742353-66742375 CTGAACAATGGTTAGCTTTGTGG - Intergenic
935620408 2:105125309-105125331 GTGAAAAGTTGGTAGGCTTGGGG - Intergenic
936770884 2:115911839-115911861 GTGAAAAATATGTGTGTTTGAGG + Intergenic
938737377 2:134198612-134198634 TTGACCACTAGGCAGGTTTGGGG - Intronic
943235460 2:185313068-185313090 GTTGACAAGAGGTAGATTTGTGG + Intergenic
943406751 2:187496869-187496891 GTGTACAAGAGGTAGGTTTCTGG - Exonic
944897537 2:204180384-204180406 GTCACCAATTGGTAGTTTTGTGG - Intergenic
946803737 2:223449264-223449286 GTTAACAAGAGGCAGGATTGAGG - Intergenic
947313081 2:228825508-228825530 CTGAATAACAGGTAGGTTAGGGG + Intergenic
1169433431 20:5561204-5561226 GTGAACAATATGGTGGTTTTGGG - Intronic
1172987222 20:39001262-39001284 GTGAACAGTAGGTGTGTTTCCGG - Intronic
1178597190 21:33964649-33964671 CTGAAGTATAGGCAGGTTTGGGG - Intergenic
950296167 3:11833426-11833448 TTGAACAGTAGGTAGGGCTGTGG - Intronic
951115093 3:18852098-18852120 GTGAACAATAGGTAGCCATTAGG - Intergenic
951944116 3:28114867-28114889 GTGAACAAAATGTACGTTTATGG - Intergenic
957714868 3:83914174-83914196 CTGAACAATGGTTAGCTTTGTGG + Intergenic
958124297 3:89335398-89335420 ATGAACAATATGTTGGTTTTAGG - Intronic
960218215 3:115069590-115069612 GAGAAAAAAAGGTAGGTTGGAGG + Intronic
960455585 3:117867133-117867155 GTGAACAACATGTAGGTTAGAGG - Intergenic
963948988 3:151177960-151177982 AAGAACAAGAGGTAGGCTTGAGG - Intronic
967468583 3:189836639-189836661 TTGAACAACAGGTAGGTGTATGG - Intronic
967858063 3:194133338-194133360 TTGAAAAATAGGTAGGATTGGGG - Intergenic
970413982 4:15838461-15838483 GTGAGCAATGGGTAGGGTGGAGG - Intronic
970968201 4:21951154-21951176 GTGAACAAGCTGTATGTTTGAGG + Intergenic
972719615 4:41683057-41683079 GTGAGTAATATTTAGGTTTGGGG - Intronic
975331513 4:73120011-73120033 GAAAACAATGGGTAGGTTTGGGG + Intronic
975538189 4:75474281-75474303 ATGAAGAATAGGCAGGTTTCCGG + Intergenic
977722211 4:100252476-100252498 ATGAACAATAGGTAGGATTTAGG + Intergenic
981898690 4:149835693-149835715 ATGAACAATAGCTAAGTCTGAGG - Intergenic
984318916 4:178165846-178165868 TAGAACAATAGGTAAATTTGTGG + Intergenic
984458325 4:179999964-179999986 GTGAAGAATAGGGATGTTTGGGG + Intergenic
984534909 4:180962471-180962493 TTGAACAATAGGGAGGTTAGGGG + Intergenic
989969326 5:50503532-50503554 GTGAAAACTGGGTAGGTATGGGG - Intergenic
991569336 5:68037825-68037847 GTGAAGAAGAGGTAGATTTGGGG + Intergenic
992078733 5:73215179-73215201 CTGAACAATAGGTTGGAATGAGG - Intergenic
992648456 5:78833950-78833972 AGGCACAAAAGGTAGGTTTGGGG + Intronic
993806264 5:92413787-92413809 GTGAACAAAAGGTTGTATTGTGG - Intergenic
998495910 5:142589000-142589022 GTGAAAAAGAGGTAGGTTTTTGG - Intergenic
998875151 5:146591543-146591565 GTCAACCATATGTGGGTTTGAGG - Intronic
999370612 5:151052816-151052838 GTGAACAAGAGGATGGTTAGGGG - Intronic
999572729 5:152938833-152938855 GTGATCAATAGGTTGACTTGGGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007745012 6:44038355-44038377 GGGAACAAGAGGTGGGTCTGGGG + Intergenic
1009827451 6:68884688-68884710 GAGAAAAACAGGTAGGTGTGGGG + Intronic
1010033736 6:71297054-71297076 GTGGGCAATAGGAAGGTTTCAGG - Intronic
1010847197 6:80723334-80723356 GTGAAGAATAGGTAGTTTTATGG - Intergenic
1010898926 6:81401595-81401617 GTGCACAACATGCAGGTTTGTGG - Intergenic
1013637134 6:112039586-112039608 GTGAACATTTGCTATGTTTGTGG - Intergenic
1014874057 6:126634045-126634067 GTAAACAATAGTTGTGTTTGTGG - Intergenic
1015574399 6:134655932-134655954 CTGTAAAATAGGGAGGTTTGTGG + Intergenic
1016796863 6:148127305-148127327 GTGAAATATAGGTAGGTAAGAGG + Intergenic
1021366589 7:19787544-19787566 GTGAACCATAGGAAGAATTGAGG + Intergenic
1022042450 7:26593380-26593402 GAAAACAATAGGTGGGTTTGGGG + Intergenic
1027838897 7:83281484-83281506 ATGAACAATAAAGAGGTTTGGGG + Intergenic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1028618461 7:92797600-92797622 GTGAAGAAAAGGTATGTCTGAGG - Intronic
1028987369 7:97018749-97018771 GGGGGCAATAGGAAGGTTTGCGG - Intergenic
1030174007 7:106631928-106631950 GGGAAGAAGAGGTTGGTTTGAGG - Intergenic
1030184831 7:106751266-106751288 GAGAACAAAAGTTAGATTTGTGG - Intergenic
1032128866 7:129213034-129213056 GAGAACAAAAGATGGGTTTGGGG - Exonic
1032165788 7:129543724-129543746 GTGAGCAGTAGGTGGGTTAGAGG - Intergenic
1032622557 7:133551321-133551343 GTATACAATAGTAAGGTTTGTGG - Intronic
1034240893 7:149609939-149609961 TTGAAAAATACGTAGGTGTGTGG - Intergenic
1037018467 8:13938280-13938302 GTTAACCATAGGTAGTTTTCAGG - Intergenic
1038359323 8:26861763-26861785 GTGAGAAATAGGTAGGTTTAGGG - Intronic
1038713786 8:29973503-29973525 GTGAACAAGAGATAGGTGTGGGG + Intergenic
1038975534 8:32691451-32691473 TGGAAAAATAGGTATGTTTGGGG - Intronic
1041928280 8:63260399-63260421 GTTCACAATAGGTAGGGTTCAGG - Intergenic
1042470918 8:69186960-69186982 GTGAACAAAAGTTAGATCTGGGG + Intergenic
1043519646 8:81030716-81030738 CAGAACAACAGGTAGGATTGGGG - Intronic
1047429436 8:124778297-124778319 GTTAACAATTGGTGGGTCTGGGG + Intergenic
1049142329 8:140966164-140966186 GTGAACAAAAAGTAGATGTGGGG - Intronic
1050302233 9:4271387-4271409 TTGAACAATATGGAGGTTAGGGG - Intronic
1055497781 9:76872652-76872674 CTGACCAATAGGGAGTTTTGAGG - Intronic
1055529065 9:77165337-77165359 GTGACCAACAGGTCAGTTTGAGG - Intergenic
1056792887 9:89637721-89637743 GTGGACAATAGGGAGGGGTGGGG - Intergenic
1059657909 9:116373048-116373070 GTGAAAAGAAGGTAGTTTTGTGG + Intronic
1061772701 9:132938465-132938487 CTGAATAAAATGTAGGTTTGAGG + Intronic
1187516977 X:19981056-19981078 GTACACAATAGGTGGGTTTAAGG + Intergenic
1188466177 X:30483860-30483882 GTTAACAGTAGGAAGTTTTGCGG - Intergenic
1188665163 X:32810455-32810477 AAGAAAAGTAGGTAGGTTTGGGG - Intronic
1189827759 X:44937347-44937369 GTAAACAAACGGAAGGTTTGTGG + Intronic
1190686106 X:52875369-52875391 GTAAACAGAAGGAAGGTTTGGGG + Intergenic
1196157066 X:112442076-112442098 GTGAACAAAAAGTAGATTAGTGG + Intergenic
1196461927 X:115941107-115941129 TAGAACAAAGGGTAGGTTTGGGG + Intergenic
1197281211 X:124538460-124538482 GTGAACAGAAGGTATATTTGAGG + Intronic
1199340420 X:146670912-146670934 GACAACAATAGTTAGGCTTGTGG - Intergenic
1200167084 X:154043943-154043965 GTCAACAGTAGGCAGATTTGTGG - Intronic
1200226813 X:154422106-154422128 GTGATCAGGAGGTAGGATTGGGG + Intergenic
1200316944 X:155144311-155144333 GTGAACAATAGGTAGGTTTGTGG + Intronic
1201557355 Y:15276985-15277007 GTGAACAAAATATAGGTTTGGGG - Intergenic
1202167979 Y:22013037-22013059 CTGAACCATGGGAAGGTTTGGGG + Intergenic
1202223382 Y:22573331-22573353 CTGAACCATGGGAAGGTTTGGGG - Intergenic
1202319733 Y:23622329-23622351 CTGAACCATGGGAAGGTTTGGGG + Intergenic
1202551035 Y:26047727-26047749 CTGAACCATGGGAAGGTTTGGGG - Intergenic