ID: 1200323722

View in Genome Browser
Species Human (GRCh38)
Location X:155216427-155216449
Sequence CACGGAATCCCGGCGGCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200323716_1200323722 0 Left 1200323716 X:155216404-155216426 CCTGCAAGTGCGAACAAGCCAAT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1200323722 X:155216427-155216449 CACGGAATCCCGGCGGCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200323722 Original CRISPR CACGGAATCCCGGCGGCCGG CGG Exonic
900343625 1:2200482-2200504 CAGGGAATGCCGGGGGCCCGGGG + Intronic
900654233 1:3747161-3747183 CGGGGACTCTCGGCGGCCGGTGG + Intergenic
900780058 1:4612178-4612200 CATGGAGTCCAGGCGGCCTGCGG + Intergenic
902581861 1:17412915-17412937 CACTGAATCCCAGAGTCCGGGGG - Intronic
904899652 1:33846896-33846918 CACTGAATCCGCGCTGCCGGTGG + Exonic
924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG + Intronic
1063930009 10:11018597-11018619 CGCGGAGTCCCGGGGTCCGGTGG + Intronic
1081774097 11:45665807-45665829 CCCGGACTTCGGGCGGCCGGCGG + Intergenic
1091713407 12:2759101-2759123 CAAGGAATGCTGGCAGCCGGAGG + Intergenic
1093435285 12:19129586-19129608 CTCCGCATCCCGGCGGCCGCCGG - Intergenic
1106248914 13:27969290-27969312 CACGGAAGGCCGCCGGCCTGGGG - Exonic
1113517786 13:110915773-110915795 CGGGGAATCCCGGCTGCCGGGGG + Intergenic
1116919843 14:50560767-50560789 CGCGGGCTCCCGGCGGCGGGCGG + Intronic
1118925769 14:70188732-70188754 CCCGGAGTCCCGGCCGCGGGCGG + Exonic
1123880633 15:24675624-24675646 CCCGGAAGCCCCGCTGCCGGTGG - Intergenic
1129313219 15:74726323-74726345 CACAGAAATCCGGCGGCGGGGGG + Intergenic
1133230922 16:4366160-4366182 CAGGGAAGCCCAGCGGCCGGAGG - Intronic
1135739752 16:24964629-24964651 CATGGAATCCCTGCCACCGGAGG + Intronic
1136186639 16:28592294-28592316 CATGAACTCCCGGCGGACGGTGG + Exonic
1136564521 16:31061964-31061986 CAAGGACTTCCGGCAGCCGGCGG - Exonic
1143146793 17:4781879-4781901 CAGTGAATCTCGGCGGCCGCTGG - Intronic
1143372990 17:6451884-6451906 CACCGAATCCCATCGGCGGGCGG - Exonic
1155297305 18:24397456-24397478 CTCGGCTTCCCGGCGGCCGCTGG - Intronic
1159045591 18:63366744-63366766 CCCGGGAACCCTGCGGCCGGCGG + Intronic
1161951353 19:7469774-7469796 CACGGGATCCAGGCCGCCCGTGG + Intronic
1164512072 19:28905539-28905561 CATGGCAGCCCGGCAGCCGGGGG + Intergenic
927468079 2:23351726-23351748 CCCGGCATCTCTGCGGCCGGAGG + Intergenic
930011402 2:46940988-46941010 CGCGGAGCCCCGGCGCCCGGGGG - Intronic
933666746 2:84970955-84970977 CCCGGAGGCCCCGCGGCCGGCGG - Intergenic
937317621 2:120941888-120941910 CATGAAATCCAGGCGGCAGGGGG + Intronic
940517285 2:154698070-154698092 CGCGGAAACTCGGCGGTCGGGGG + Intergenic
947929284 2:233950098-233950120 CACGGTGTCCCGGCTGCCTGAGG + Exonic
948920377 2:241063514-241063536 CACGGAATCCTGGGGGCATGTGG + Intronic
949027962 2:241775114-241775136 GACGGAGGCCCGGCGGCCAGAGG - Intergenic
1175504930 20:59475397-59475419 CACGGACTCCCGCAGGCAGGTGG + Intergenic
953909250 3:46883421-46883443 CCCGGCGTCCCGGCGGCCCGAGG - Exonic
954703681 3:52466885-52466907 CACAGAATCCCGGCAGGTGGTGG + Intronic
961170839 3:124796730-124796752 CCCGGAATCCCACCGGCCGCAGG + Exonic
963852344 3:150221395-150221417 CCCGGGGTCTCGGCGGCCGGCGG + Intergenic
976826512 4:89266320-89266342 CAAGGAATCCTGGCAGCTGGTGG + Intronic
977637873 4:99321655-99321677 CAAGGAATTCCAGAGGCCGGGGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984756747 4:183331702-183331724 CACGGGAGCCTGGCGGCCGCAGG - Intergenic
989262106 5:39429812-39429834 CACAGATTCCGGGCGGGCGGCGG - Intronic
1002888279 6:1313788-1313810 CTCCGAGGCCCGGCGGCCGGCGG + Exonic
1003552368 6:7109601-7109623 CACGGATGCACGGCGGCCGAGGG - Intronic
1016597204 6:145815334-145815356 CCCTGGATCCCGGCGGGCGGCGG + Intergenic
1017446352 6:154510343-154510365 CCCGGGATCCCGGCGGCGGCGGG - Exonic
1025730004 7:64100484-64100506 CCCGGAAGCCCGGCGGTGGGAGG + Intronic
1036750064 8:11438098-11438120 CACGGAAGCCAGGCGGCCAGTGG + Exonic
1043942584 8:86212560-86212582 CACGGAATCATGGAGGCTGGAGG + Intergenic
1047296216 8:123572684-123572706 CACTGAATCCCAGAGGCCAGTGG + Intergenic
1060204111 9:121672396-121672418 CATGGAAACACGGCGGCCTGAGG - Intronic
1062447622 9:136602218-136602240 CACGGGACTCCTGCGGCCGGGGG + Intergenic
1197774317 X:130110047-130110069 CACGGAACCCAGGCTGCCGGGGG + Intronic
1200323722 X:155216427-155216449 CACGGAATCCCGGCGGCCGGCGG + Exonic