ID: 1200326106

View in Genome Browser
Species Human (GRCh38)
Location X:155241539-155241561
Sequence GTAGGGGGAGCAGGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326106_1200326117 14 Left 1200326106 X:155241539-155241561 CCATCATCCCCTGCTCCCCCTAC No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326106_1200326118 15 Left 1200326106 X:155241539-155241561 CCATCATCCCCTGCTCCCCCTAC No data
Right 1200326118 X:155241577-155241599 TAAAGACACTGACATCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326106 Original CRISPR GTAGGGGGAGCAGGGGATGA TGG (reversed) Intergenic
No off target data available for this crispr