ID: 1200326113

View in Genome Browser
Species Human (GRCh38)
Location X:155241557-155241579
Sequence TTATATTGAAGAGGATGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326113_1200326118 -3 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326118 X:155241577-155241599 TAAAGACACTGACATCTGTAGGG No data
1200326113_1200326119 16 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326119 X:155241596-155241618 AGGGAGAAGCACCTTATTCAAGG No data
1200326113_1200326121 27 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326113_1200326117 -4 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326113 Original CRISPR TTATATTGAAGAGGATGGGT AGG (reversed) Intergenic
No off target data available for this crispr