ID: 1200326114

View in Genome Browser
Species Human (GRCh38)
Location X:155241561-155241583
Sequence GTCTTTATATTGAAGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326114_1200326121 23 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326114_1200326117 -8 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326114_1200326119 12 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326119 X:155241596-155241618 AGGGAGAAGCACCTTATTCAAGG No data
1200326114_1200326118 -7 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326118 X:155241577-155241599 TAAAGACACTGACATCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326114 Original CRISPR GTCTTTATATTGAAGAGGAT GGG (reversed) Intergenic