ID: 1200326115

View in Genome Browser
Species Human (GRCh38)
Location X:155241562-155241584
Sequence TGTCTTTATATTGAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326115_1200326118 -8 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326118 X:155241577-155241599 TAAAGACACTGACATCTGTAGGG No data
1200326115_1200326121 22 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326115_1200326119 11 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326119 X:155241596-155241618 AGGGAGAAGCACCTTATTCAAGG No data
1200326115_1200326117 -9 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326115 Original CRISPR TGTCTTTATATTGAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr