ID: 1200326116

View in Genome Browser
Species Human (GRCh38)
Location X:155241566-155241588
Sequence TCAGTGTCTTTATATTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326116_1200326121 18 Left 1200326116 X:155241566-155241588 CCTCTTCAATATAAAGACACTGA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326116_1200326119 7 Left 1200326116 X:155241566-155241588 CCTCTTCAATATAAAGACACTGA No data
Right 1200326119 X:155241596-155241618 AGGGAGAAGCACCTTATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326116 Original CRISPR TCAGTGTCTTTATATTGAAG AGG (reversed) Intergenic
No off target data available for this crispr