ID: 1200326117

View in Genome Browser
Species Human (GRCh38)
Location X:155241576-155241598
Sequence ATAAAGACACTGACATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326111_1200326117 -2 Left 1200326111 X:155241555-155241577 CCCCTACCCATCCTCTTCAATAT No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326107_1200326117 7 Left 1200326107 X:155241546-155241568 CCCCTGCTCCCCCTACCCATCCT No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326108_1200326117 6 Left 1200326108 X:155241547-155241569 CCCTGCTCCCCCTACCCATCCTC No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326114_1200326117 -8 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326113_1200326117 -4 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326109_1200326117 5 Left 1200326109 X:155241548-155241570 CCTGCTCCCCCTACCCATCCTCT No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326106_1200326117 14 Left 1200326106 X:155241539-155241561 CCATCATCCCCTGCTCCCCCTAC No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326110_1200326117 -1 Left 1200326110 X:155241554-155241576 CCCCCTACCCATCCTCTTCAATA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326115_1200326117 -9 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data
1200326112_1200326117 -3 Left 1200326112 X:155241556-155241578 CCCTACCCATCCTCTTCAATATA No data
Right 1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326117 Original CRISPR ATAAAGACACTGACATCTGT AGG Intergenic
No off target data available for this crispr