ID: 1200326121

View in Genome Browser
Species Human (GRCh38)
Location X:155241607-155241629
Sequence CCTTATTCAAGGCCATACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326114_1200326121 23 Left 1200326114 X:155241561-155241583 CCCATCCTCTTCAATATAAAGAC No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326110_1200326121 30 Left 1200326110 X:155241554-155241576 CCCCCTACCCATCCTCTTCAATA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326113_1200326121 27 Left 1200326113 X:155241557-155241579 CCTACCCATCCTCTTCAATATAA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326111_1200326121 29 Left 1200326111 X:155241555-155241577 CCCCTACCCATCCTCTTCAATAT No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326115_1200326121 22 Left 1200326115 X:155241562-155241584 CCATCCTCTTCAATATAAAGACA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326112_1200326121 28 Left 1200326112 X:155241556-155241578 CCCTACCCATCCTCTTCAATATA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data
1200326116_1200326121 18 Left 1200326116 X:155241566-155241588 CCTCTTCAATATAAAGACACTGA No data
Right 1200326121 X:155241607-155241629 CCTTATTCAAGGCCATACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326121 Original CRISPR CCTTATTCAAGGCCATACAG CGG Intergenic
No off target data available for this crispr