ID: 1200326183

View in Genome Browser
Species Human (GRCh38)
Location X:155242121-155242143
Sequence CAGACTGCACAAAAGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200326177_1200326183 29 Left 1200326177 X:155242069-155242091 CCAGAGGGTGGCTTTAGGCAGAG No data
Right 1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200326183 Original CRISPR CAGACTGCACAAAAGGACAT AGG Intergenic
No off target data available for this crispr