ID: 1200333278

View in Genome Browser
Species Human (GRCh38)
Location X:155320151-155320173
Sequence TCTCTTTAGCACCAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200333278_1200333281 -2 Left 1200333278 X:155320151-155320173 CCTGCCTACTGGTGCTAAAGAGA 0: 1
1: 0
2: 0
3: 40
4: 395
Right 1200333281 X:155320172-155320194 GAGCAGTGGATCTCCCAGCATGG 0: 4
1: 373
2: 820
3: 516
4: 373
1200333278_1200333285 18 Left 1200333278 X:155320151-155320173 CCTGCCTACTGGTGCTAAAGAGA 0: 1
1: 0
2: 0
3: 40
4: 395
Right 1200333285 X:155320192-155320214 TGGTGCTCAAGCTCTGCTAAGGG 0: 2
1: 7
2: 110
3: 299
4: 555
1200333278_1200333284 17 Left 1200333278 X:155320151-155320173 CCTGCCTACTGGTGCTAAAGAGA 0: 1
1: 0
2: 0
3: 40
4: 395
Right 1200333284 X:155320191-155320213 ATGGTGCTCAAGCTCTGCTAAGG 0: 3
1: 6
2: 113
3: 280
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200333278 Original CRISPR TCTCTTTAGCACCAGTAGGC AGG (reversed) Intronic
900127375 1:1074522-1074544 TCCCTATAGCCCCAGGAGGCTGG + Intergenic
902141535 1:14360986-14361008 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
903566861 1:24274304-24274326 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
905518401 1:38578784-38578806 TGTCTTTTGCTCCATTAGGCAGG - Intergenic
906586832 1:46985458-46985480 TCTCTTCAGAGCCAGGAGGCAGG - Intergenic
906843032 1:49160597-49160619 TCTCTTTAGAGCCATCAGGCAGG + Intronic
907015236 1:51005816-51005838 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
908601358 1:65743744-65743766 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
908791022 1:67781602-67781624 TCTCTTCAGCAGCTGTAGGGAGG + Intronic
908903895 1:68985938-68985960 TCTCTTCAGAGCCAGTAGGCAGG - Intergenic
909047438 1:70727702-70727724 ACTCTCTAGAACCAGCAGGCTGG + Intergenic
909415719 1:75403289-75403311 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
909493076 1:76247365-76247387 TCTCTTTAGAGCCGGCAGGCAGG + Intronic
909536373 1:76741198-76741220 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
909690096 1:78397773-78397795 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
909874404 1:80784138-80784160 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
910177258 1:84443663-84443685 TGTCTTCAGAACCAGCAGGCAGG - Intergenic
912235395 1:107844898-107844920 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
912276373 1:108262460-108262482 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
912291855 1:108431898-108431920 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
913562427 1:120035289-120035311 TCTCTTAAGAACCAGTTGGGAGG + Intronic
913635697 1:120758318-120758340 TCTCTTAAGAACCAGTTGGGAGG - Intergenic
916140599 1:161693720-161693742 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
916587869 1:166164708-166164730 TCTTTTTAGCAGCAGTTTGCAGG - Intronic
917232748 1:172855818-172855840 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
918013672 1:180611481-180611503 CCTCTTTAGCAGCTGAAGGCAGG - Intergenic
918646634 1:186913922-186913944 TCACTATAGCATCAGTAGGTTGG - Intronic
919146721 1:193644942-193644964 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
919599049 1:199600060-199600082 TCTCTTCAGAGCCAGCAGGCGGG - Intergenic
921484804 1:215703360-215703382 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
922765814 1:228156064-228156086 TCTCCCTGGCTCCAGTAGGCAGG - Intronic
924179931 1:241430507-241430529 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1065120565 10:22526076-22526098 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1065120942 10:22530025-22530047 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1067209637 10:44249463-44249485 TCTCTTTAGAGCCAGCAGGCAGG + Intergenic
1067329397 10:45301098-45301120 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1067463339 10:46474536-46474558 TCTCTGTAGTTCCAGAAGGCAGG - Intergenic
1067623855 10:47910102-47910124 TCTCTGTAGTTCCAGAAGGCAGG + Intergenic
1068469905 10:57448025-57448047 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1068575200 10:58676639-58676661 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1068951625 10:62782899-62782921 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1071975806 10:90954848-90954870 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1072375640 10:94813328-94813350 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
1072389510 10:94968975-94968997 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
1073698185 10:105894022-105894044 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1075115197 10:119620288-119620310 TCTCTCTAGCACCCGTGGGAAGG - Intergenic
1076547169 10:131253151-131253173 TCTCTTCAGCACCAGGAGCCCGG + Intronic
1076907367 10:133369761-133369783 GCTCTTTAGCACCATGAGGCAGG + Intronic
1077428255 11:2498235-2498257 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1078355489 11:10628993-10629015 TCTCTTGAGCAGCAGCAGGGAGG - Intronic
1078707300 11:13756905-13756927 TCTCTTTATCAACAGAGGGCTGG - Intergenic
1079993691 11:27273451-27273473 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1080977203 11:37357160-37357182 TCTCTTCAGACCCAGCAGGCAGG - Intergenic
1082670761 11:56033719-56033741 TCTCCTTAGAGCCAGCAGGCAGG - Intergenic
1082872088 11:57953085-57953107 TCTCTTTAGAGCCAGCAGGCAGG + Intergenic
1083385469 11:62306202-62306224 TGTCTTCAGAACCGGTAGGCAGG + Intergenic
1085683743 11:78602981-78603003 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1085850114 11:80109919-80109941 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1085884509 11:80506170-80506192 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1086129253 11:83383562-83383584 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1087305819 11:96487732-96487754 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1087667842 11:101070915-101070937 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1088078258 11:105878462-105878484 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1088702598 11:112426651-112426673 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1089285419 11:117404700-117404722 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1089882404 11:121787358-121787380 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1090711966 11:129395251-129395273 TCTATTTAGTTCCCGTAGGCTGG + Intronic
1090811739 11:130250356-130250378 TCTCTTCAGAACCTGCAGGCAGG - Intronic
1091672354 12:2461474-2461496 TATATTTAACACCAGGAGGCTGG - Intronic
1091956151 12:4645233-4645255 TCTCTATAGCAACAGTAGTGAGG + Intronic
1092000202 12:5025334-5025356 TCTGCTCAGCACCAGTAAGCTGG - Intergenic
1092628905 12:10358073-10358095 TCTCTTCAGAACCGGCAGGCAGG + Intergenic
1093835548 12:23824633-23824655 TCTCTTCAGAGCCTGTAGGCAGG + Intronic
1093902766 12:24654600-24654622 TCTCTTCAGAGCCGGTAGGCAGG + Intergenic
1094139981 12:27171421-27171443 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1094273741 12:28645699-28645721 ACTCTTCAGAGCCAGTAGGCAGG + Intergenic
1095547311 12:43387537-43387559 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1095674293 12:44898201-44898223 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1095831427 12:46591227-46591249 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1096212578 12:49777893-49777915 TCTCCTTAGCACCAGACTGCAGG - Intergenic
1096524039 12:52200223-52200245 TCTCCTCAGCACCAGCAGGCAGG + Intergenic
1097752972 12:63378296-63378318 TCTCTTCAGAACCATAAGGCAGG - Intergenic
1098052987 12:66473420-66473442 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1098635673 12:72780795-72780817 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1098780215 12:74676977-74676999 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1099486200 12:83232356-83232378 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1099492097 12:83300341-83300363 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1099897599 12:88668049-88668071 TCTCTTCAGAGCCTGTAGGCAGG - Intergenic
1099943905 12:89222547-89222569 TCTCTTTGGAGCCAGCAGGCAGG + Intergenic
1100996219 12:100303806-100303828 TCTCTTTACAGCCAGTAGGGAGG + Intronic
1106042246 13:26104140-26104162 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1107674037 13:42776498-42776520 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1108048759 13:46408639-46408661 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1108235102 13:48394839-48394861 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1108236889 13:48417018-48417040 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1108597223 13:51959970-51959992 TCTCTTAATGACCAGTAGGTGGG - Intronic
1109541292 13:63781984-63782006 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1109891210 13:68617221-68617243 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1111056122 13:82953194-82953216 TCTCTTCAGAGCCAGTAGGCAGG - Intergenic
1111607368 13:90558465-90558487 TCTCTTCAGGACAAGTAGGATGG - Intergenic
1111628004 13:90813791-90813813 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1111635122 13:90893244-90893266 TCTCTTCAGAGCCAGCAGGCGGG - Intergenic
1112546464 13:100376396-100376418 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1113097928 13:106686368-106686390 TCTGTCTAGCACCAGAGGGCTGG - Intergenic
1113131466 13:107042164-107042186 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1113747099 13:112752787-112752809 TCTCTTTAGCAATTGTAGGATGG - Intronic
1114695426 14:24623264-24623286 TCTCTTCAGAACCAGCAGGCAGG + Intergenic
1114710118 14:24769042-24769064 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1115124246 14:29972914-29972936 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1115867174 14:37760563-37760585 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1116002463 14:39259143-39259165 TCTCTTTAGAGCCGGCAGGCAGG + Intronic
1116771415 14:49131320-49131342 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1117526930 14:56618057-56618079 TCTCTGTGGCACCAGTGGGGTGG - Intronic
1117821909 14:59658343-59658365 TCTCTTTAGAGCCAGAAGGCAGG - Intronic
1117859414 14:60074054-60074076 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1120137322 14:80885219-80885241 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1120449987 14:84655116-84655138 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1120554062 14:85907467-85907489 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1121207272 14:92179907-92179929 TTTCTTTGGCACCAGTATGTAGG + Intergenic
1122051856 14:99066253-99066275 TCTGTTTAGCACCGGGAGGTGGG - Intergenic
1123480879 15:20629683-20629705 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1123637133 15:22370682-22370704 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1124084255 15:26531947-26531969 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1125288571 15:38120316-38120338 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1125319983 15:38475544-38475566 TCTCTTCAGAGCCAGTAGCCCGG + Intronic
1128499288 15:68216220-68216242 TCTCTCTAGCACCAGTTTGATGG + Intronic
1128883731 15:71266051-71266073 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1130441975 15:83963600-83963622 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1130724081 15:86420058-86420080 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1133512125 16:6469936-6469958 ACTCTTTATCACCAGTAAGATGG - Intronic
1137397040 16:48123559-48123581 TCTCTTTAGCAACAGCAGAGTGG + Intronic
1137551767 16:49442330-49442352 TCTCTATAGCTCCAGAAGACTGG - Intergenic
1138151604 16:54662254-54662276 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1138799776 16:60013333-60013355 TCTCTTTAGAGCCAGGAGGCAGG - Intergenic
1138799782 16:60013364-60013386 TCTTTTTAGAGCCAGCAGGCAGG - Intergenic
1138886966 16:61091363-61091385 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1141749065 16:85946241-85946263 TGTCTTTAGCACCAGTACAATGG + Intergenic
1144012591 17:11163800-11163822 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1150090820 17:62323185-62323207 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1150884671 17:69071184-69071206 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1153798517 18:8647319-8647341 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1154101498 18:11478995-11479017 TCTCTTCAGATCCAGCAGGCAGG + Intergenic
1154205705 18:12335030-12335052 TCTCTTTAGGAACAATAGGAAGG - Intronic
1156415085 18:36879576-36879598 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1158373222 18:56832432-56832454 TCTCTTCAGAGCCAGCAGGCTGG - Intronic
1159076695 18:63688620-63688642 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1159385915 18:67725580-67725602 TGTCTTCAGAACCAGCAGGCAGG + Intergenic
1161332530 19:3695160-3695182 TCCCGTTAGCACCAGAAGACTGG + Intronic
1162473841 19:10888173-10888195 CCTCTTTAGCACCAGGAAGCAGG + Intronic
925566328 2:5258238-5258260 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
925729060 2:6904368-6904390 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
928830601 2:35478164-35478186 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
929272747 2:39990798-39990820 TCTCTTCAGCAGCAGGAGACTGG - Intergenic
930951383 2:57147164-57147186 TCTCTTCAGAGCCAGTAGACAGG - Intergenic
931212043 2:60206878-60206900 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
931814885 2:65890546-65890568 TCTCTTCAGAACCAGCAGGCAGG - Intergenic
932468748 2:71940214-71940236 CCTCTCTAGCCCCAGTTGGCAGG + Intergenic
933413151 2:81950751-81950773 TCTCTTCAGAACCAGCAGGCAGG + Intergenic
935567899 2:104629247-104629269 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
935961545 2:108430038-108430060 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
936999918 2:118456828-118456850 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
937143186 2:119619179-119619201 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
937280299 2:120713099-120713121 TGTCTTCAGCAGCAGGAGGCTGG + Intergenic
937573575 2:123392268-123392290 TCTCTTTAGAGCCATCAGGCAGG - Intergenic
938839884 2:135150059-135150081 TTTCTTTATCACTAATAGGCAGG + Intronic
938952265 2:136266296-136266318 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
939116855 2:138070887-138070909 TCTCTTCAGAACTGGTAGGCAGG + Intergenic
939180431 2:138796532-138796554 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
939876641 2:147586007-147586029 TCTCTTCAGAACCAGCAGGCAGG + Intergenic
939942050 2:148362579-148362601 TCTCTTCAGAGCCAGTAGGAAGG - Intronic
940099343 2:150016237-150016259 TCACTCTAGCACCAGGAAGCTGG - Intergenic
940370606 2:152896470-152896492 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
941478094 2:165972368-165972390 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
941682277 2:168412588-168412610 TCTCTTCAGAGCCAGTAGGCAGG + Intergenic
942411095 2:175709702-175709724 TCTCTTCAGAGCCAGTAGGCAGG - Intergenic
942576931 2:177373747-177373769 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
942953637 2:181750086-181750108 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
943074596 2:183179086-183179108 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
944215263 2:197248105-197248127 TCCCTGCAGCAGCAGTAGGCAGG - Intronic
944292087 2:198018824-198018846 TCTCTTTAGAGCCGTTAGGCAGG - Intronic
944764410 2:202849724-202849746 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
945628200 2:212237625-212237647 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
946146022 2:217731657-217731679 TCGCTATAGCACCAGTGGACAGG - Intronic
947225796 2:227839234-227839256 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
947492171 2:230604235-230604257 TCTCTTCAGAGCCAGTAGGCAGG - Intergenic
947998077 2:234545103-234545125 TCTCTTCACCACCAGGGGGCAGG - Intergenic
948349994 2:237331959-237331981 TCTCTTTATCACAGGTAGACAGG + Intronic
948423770 2:237875727-237875749 TCTCTCTAGCAGCTGTGGGCTGG + Intronic
1169808582 20:9584833-9584855 TCTCTTTATGAACAATAGGCAGG + Intronic
1170229338 20:14027960-14027982 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
1171000907 20:21414428-21414450 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG + Intronic
1173319169 20:41971992-41972014 TCTCTGTATCTCCAGTAGTCTGG + Intergenic
1173751107 20:45477721-45477743 TCTCTTCAGAACCGGCAGGCAGG + Intronic
1176344378 21:5728471-5728493 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1176351192 21:5849055-5849077 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1176500449 21:7595985-7596007 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1176538699 21:8126540-8126562 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1177541043 21:22494090-22494112 TCTCTTTAGAGCCGGCAGGCAGG - Intergenic
1177694626 21:24555429-24555451 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1179254649 21:39704762-39704784 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1180250334 21:46582019-46582041 CCTCTTCAGAACCAGCAGGCAGG + Intergenic
1180250661 21:46585269-46585291 TCTTTATAGCAGCAGGAGGCAGG + Intergenic
1180902591 22:19385490-19385512 TGTCTTTAGCGCCACCAGGCAGG + Intronic
1182870359 22:33641009-33641031 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1182897057 22:33867677-33867699 TCTACTTCGCACCAGCAGGCTGG + Intronic
1183182657 22:36271443-36271465 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1184514083 22:44950421-44950443 TGTCCTTAGCAGCAGCAGGCAGG + Intronic
1184769472 22:46589116-46589138 TCCCTGGAGCACCAGCAGGCTGG - Intronic
1203243647 22_KI270733v1_random:42895-42917 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
949251978 3:1996148-1996170 TTTCTTTAGCACAAATAGGGAGG - Intergenic
949423478 3:3891169-3891191 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
951254443 3:20432672-20432694 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
951687547 3:25362027-25362049 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
951741736 3:25932078-25932100 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
952098567 3:29984947-29984969 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
953221833 3:40978795-40978817 TCTCATTATCACCAGCAGTCTGG - Intergenic
953941023 3:47097259-47097281 TTTCTTTAGAACCAGCTGGCTGG - Intronic
956398073 3:68847064-68847086 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
957249719 3:77757338-77757360 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
957776547 3:84761604-84761626 TCTCTTCAGAACCAGCAAGCAGG - Intergenic
957930895 3:86876715-86876737 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
958694516 3:97510734-97510756 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
959025705 3:101237310-101237332 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
959747578 3:109795351-109795373 TCTCTTCAGATCCAGCAGGCAGG - Intergenic
959859861 3:111204826-111204848 TGGCTTTAACACCAGTAGGAAGG - Intronic
959881150 3:111446653-111446675 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
960776570 3:121262911-121262933 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
961998193 3:131268815-131268837 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
962064431 3:131963825-131963847 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
962658005 3:137568970-137568992 TCTCTTTACCACTACTAGGCTGG - Intergenic
963013915 3:140802833-140802855 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
963629246 3:147712707-147712729 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
963998507 3:151739560-151739582 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
964371318 3:156003635-156003657 TCTCTTTAGCGCCGGCAGGCAGG + Intergenic
964413924 3:156427887-156427909 TCACATTAGGAGCAGTAGGCCGG + Intronic
964543329 3:157804075-157804097 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
965091018 3:164162969-164162991 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
966637862 3:182156254-182156276 TCTCTTCAGAGACAGTAGGCGGG + Intergenic
967715644 3:192758636-192758658 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
968819945 4:2843332-2843354 TCTCCTCAGCACCCGCAGGCCGG + Intergenic
969132458 4:5001913-5001935 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
970304770 4:14719535-14719557 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
971430011 4:26556062-26556084 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972164374 4:36264659-36264681 GATCTTTAGGGCCAGTAGGCTGG + Intergenic
973264307 4:48195999-48196021 TCTCTGTACCACCAGAAGGGAGG - Intronic
973273056 4:48280507-48280529 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
974251725 4:59394071-59394093 TCTTTTTAGAGCCAGCAGGCAGG + Intergenic
974265703 4:59583786-59583808 TCTCTTCAGAACCATGAGGCAGG + Intergenic
975149354 4:71004506-71004528 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
975513750 4:75221909-75221931 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
976023890 4:80664287-80664309 TCTCTTCAGATCCAGCAGGCAGG + Intronic
976065604 4:81184087-81184109 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
976300141 4:83508957-83508979 CCCCCTTTGCACCAGTAGGCTGG + Intronic
977723428 4:100267321-100267343 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
977994514 4:103485354-103485376 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
978186006 4:105857956-105857978 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
978254706 4:106680512-106680534 TCTCTTTAGCATCATTCAGCAGG - Intergenic
978313331 4:107409883-107409905 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
979012375 4:115387841-115387863 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
979022826 4:115524846-115524868 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
979421443 4:120509705-120509727 TCTCTTCAGAATCAGCAGGCAGG - Intergenic
979461564 4:120990242-120990264 TCTCTTCAGAGCCAGTAGGCAGG + Intergenic
979668221 4:123336231-123336253 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
979819328 4:125151399-125151421 TCTCTTCAGAACCAGAAGGCAGG + Intergenic
980200641 4:129652099-129652121 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
980494122 4:133569869-133569891 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
980633867 4:135473494-135473516 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
980769380 4:137351472-137351494 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
980855272 4:138431978-138432000 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
980888074 4:138785171-138785193 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
983485841 4:168330928-168330950 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
983596263 4:169471672-169471694 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
983949403 4:173622115-173622137 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
984269774 4:177536658-177536680 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
985788854 5:1914711-1914733 TCTCCTTAGCACAAGTGGGCAGG + Intergenic
987642992 5:20634791-20634813 TTGCATTGGCACCAGTAGGCTGG - Intergenic
988627972 5:32898413-32898435 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
988719261 5:33859602-33859624 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
988775031 5:34469672-34469694 TCTCTTCAGAGCCAGAAGGCAGG - Intergenic
989194215 5:38700230-38700252 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
990183717 5:53190879-53190901 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
990745800 5:58958635-58958657 TCTCTTCAGACCCAGCAGGCAGG + Intergenic
990837855 5:60042388-60042410 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
991025679 5:62026809-62026831 TCTCTTCAGAACCAGCAGGCAGG + Intergenic
991242381 5:64474648-64474670 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
991934805 5:71790659-71790681 TCTCTTCAGACCCAGCAGGCAGG - Intergenic
992316913 5:75565912-75565934 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
993145205 5:84085740-84085762 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
993166006 5:84355833-84355855 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
993381805 5:87217414-87217436 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
993757575 5:91750760-91750782 TCTCTTCAGGGCCAGCAGGCAGG + Intergenic
993891740 5:93483041-93483063 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
993911609 5:93690647-93690669 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
994378133 5:99038198-99038220 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
994492596 5:100465442-100465464 TCTCTTAATATCCAGTAGGCTGG - Intergenic
994686411 5:102959006-102959028 TCTCTTTAGCATTATTAGGAAGG - Intronic
995808619 5:116080770-116080792 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
996592321 5:125161270-125161292 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
996610287 5:125370948-125370970 TCTCTTTACCACCCTTTGGCTGG - Intergenic
996648111 5:125841285-125841307 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
996910831 5:128655519-128655541 TTTCTTTAGAGCCAGCAGGCAGG + Intronic
997618786 5:135271622-135271644 TTTCATTAGCACCATTTGGCAGG + Intronic
998752038 5:145333317-145333339 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
998972725 5:147610730-147610752 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
999030017 5:148280830-148280852 TCTTTTTAGAGCCAGCAGGCAGG + Intronic
999688363 5:154122749-154122771 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1000194716 5:158946733-158946755 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1000860373 5:166450075-166450097 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1003515208 6:6812076-6812098 TCTCTTTATCAGCAGCAGCCAGG + Intergenic
1005274239 6:24199102-24199124 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1006921782 6:37632396-37632418 TCTCTTTGGCACCTGTCGACAGG - Exonic
1007858187 6:44879519-44879541 TCTCTTCAGAACCAGCAGGCAGG - Intronic
1008896787 6:56565745-56565767 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1009455319 6:63849280-63849302 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1009959455 6:70501045-70501067 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
1010936635 6:81870188-81870210 TCTCTTTAGAGCCAGCAGGCAGG - Intergenic
1011553732 6:88553129-88553151 TCTCCTTAGGACAAGTAGACTGG - Intergenic
1012644362 6:101661023-101661045 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1012756128 6:103232628-103232650 CATCTTTAGAACAAGTAGGCCGG - Intergenic
1012870938 6:104671672-104671694 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1013038045 6:106405477-106405499 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1013320191 6:108980548-108980570 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1014466387 6:121761087-121761109 TCTCTTCAGAGCCTGTAGGCAGG - Intergenic
1014836500 6:126166658-126166680 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1014968130 6:127781942-127781964 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1015162961 6:130173742-130173764 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1015173950 6:130286147-130286169 TTTGTTTAGCACCAGAAGCCAGG + Intronic
1015623345 6:135155892-135155914 TCTCTTCAGAGCCAGTAGGCAGG + Intergenic
1016483446 6:144507811-144507833 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1017197364 6:151716378-151716400 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1017713188 6:157187929-157187951 TCTCTTCTGCAGCACTAGGCGGG + Intronic
1018507781 6:164490508-164490530 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1020338935 7:7088823-7088845 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1020639951 7:10742514-10742536 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1020874216 7:13673567-13673589 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1021207919 7:17807558-17807580 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1021805689 7:24352731-24352753 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1023273833 7:38496426-38496448 TCTCTTCAGCTCATGTAGGCAGG - Intronic
1024998468 7:55294460-55294482 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1027843400 7:83342218-83342240 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1027864516 7:83629355-83629377 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1029004498 7:97194446-97194468 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1030159592 7:106493466-106493488 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1030736477 7:113054593-113054615 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1031031854 7:116743628-116743650 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1031613716 7:123856732-123856754 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1031902660 7:127428308-127428330 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1032367769 7:131316005-131316027 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1032883407 7:136114376-136114398 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1033634080 7:143192634-143192656 TCTCTTGAGCCCCAGTAAACAGG + Intergenic
1038862129 8:31399226-31399248 TTTCTTTGACACCAGTGGGCAGG - Intergenic
1041882492 8:62767761-62767783 TCTCTATAGCAACATGAGGCTGG - Intronic
1042622656 8:70723862-70723884 TCTCTTCAGAGCCAGTAGGTGGG + Intronic
1042773686 8:72405729-72405751 ACTCTTTAGAGCCAGCAGGCAGG - Intergenic
1042946233 8:74157098-74157120 TCTCTTCAGAGCCAGCAGGCGGG - Intergenic
1042969259 8:74390730-74390752 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1044940200 8:97334686-97334708 TCTCTTTAGAGTCAGCAGGCAGG + Intergenic
1046106551 8:109673125-109673147 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1046781370 8:118219000-118219022 TCTCTAAAGCAACAATAGGCTGG + Intronic
1046932936 8:119859015-119859037 TCTGGATAGCAGCAGTAGGCTGG + Intergenic
1048942671 8:139415363-139415385 TGTCTTGTGCTCCAGTAGGCTGG - Intergenic
1051026994 9:12624866-12624888 TCACATTAGTCCCAGTAGGCAGG + Intergenic
1051571435 9:18563559-18563581 TCTCTTTAGAGCCAGCAGGCAGG + Intronic
1051674526 9:19546237-19546259 TCTCTTCAGAGCCAGTAGGCAGG + Intronic
1051814369 9:21087806-21087828 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1052096536 9:24391034-24391056 TCTCTTTAGAGCCAGCAGGCAGG + Intergenic
1052281165 9:26735118-26735140 TCTCTTCAGAGCCAGTAGGCAGG + Intergenic
1052497639 9:29247521-29247543 TCCCTGTAGAAACAGTAGGCTGG + Intergenic
1052628370 9:31005311-31005333 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1054719826 9:68593694-68593716 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1054985932 9:71262051-71262073 TCTCTTCAGAGCCAGCAGGCTGG + Intronic
1055338927 9:75261509-75261531 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1055345001 9:75326693-75326715 TCTCTTCAGAACCAGCAGGCAGG + Intergenic
1055386783 9:75771488-75771510 TCTCTTTAGAGCCAGCAGGCAGG + Intergenic
1055390896 9:75821294-75821316 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1057311091 9:93943716-93943738 TCAGTTTACCACCAGCAGGCAGG + Intergenic
1057460368 9:95255149-95255171 TCTCTTCAGAGCCAGCAGGCGGG - Intronic
1058029322 9:100177719-100177741 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1062546349 9:137065275-137065297 TCTCTGCAGCATCAGGAGGCAGG - Intronic
1186181268 X:6975760-6975782 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1186832563 X:13404845-13404867 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1188554971 X:31400905-31400927 TCTCTTTGGCTCCAGTGGGCAGG + Intronic
1188561191 X:31470696-31470718 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1188893241 X:35635922-35635944 TGTCTTCAGAACCAGCAGGCAGG + Intergenic
1189575046 X:42342918-42342940 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1189587484 X:42475291-42475313 TCTCTTTAGGTCCAGTAGCAAGG + Intergenic
1189590695 X:42507624-42507646 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1189937817 X:46087714-46087736 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1190341405 X:49299557-49299579 TCTCTTGAGAGCCAGCAGGCAGG + Intronic
1191005130 X:55703016-55703038 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1191119784 X:56891213-56891235 TCTCTTCAGATCCAGCAGGCAGG - Intergenic
1191632003 X:63331621-63331643 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1191848540 X:65568866-65568888 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1191969722 X:66799630-66799652 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1192228511 X:69246502-69246524 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1192953120 X:76039166-76039188 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1192999568 X:76549991-76550013 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1193079403 X:77390793-77390815 TCTCTTCAGAGCCAATAGGCAGG - Intergenic
1193253970 X:79325209-79325231 TCTCTTCAGAGCCAGGAGGCAGG + Intergenic
1193389222 X:80906699-80906721 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1193394527 X:80968196-80968218 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1193830056 X:86279136-86279158 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1193878786 X:86896447-86896469 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1193897323 X:87129199-87129221 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1194021307 X:88695108-88695130 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1194203078 X:90978678-90978700 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1194208457 X:91039719-91039741 TCTCTTCAGAGCCAGTAGGCAGG + Intergenic
1194315237 X:92369063-92369085 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1194559602 X:95403992-95404014 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1194576302 X:95618466-95618488 TCTCTTTAGGCCCGGCAGGCAGG + Intergenic
1194624833 X:96215122-96215144 TCTCTTCAGAGCCAGTAGGAAGG - Intergenic
1194643341 X:96429120-96429142 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1194771855 X:97915845-97915867 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1195344899 X:103940203-103940225 TCTCTTCAGATCCAGCAGGCAGG + Intronic
1195434641 X:104828675-104828697 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1195833680 X:109088806-109088828 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1196133447 X:112181774-112181796 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1196312435 X:114184075-114184097 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1196467106 X:115983579-115983601 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1197054192 X:122097377-122097399 TGTCTTTATCACCAGTATGAAGG + Intergenic
1197157275 X:123283840-123283862 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1197880701 X:131163957-131163979 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1198002218 X:132451216-132451238 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1198489992 X:137130029-137130051 TCTCTTCAGAGCCAGCAGGCAGG - Intergenic
1199012132 X:142770321-142770343 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1199094526 X:143724068-143724090 TCTCTTCAGATCCAGTAGGCAGG - Intergenic
1199469767 X:148181588-148181610 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1199801272 X:151253308-151253330 TCTCTTCAGACCCAGCAGGCAGG - Intergenic
1199802987 X:151269990-151270012 TCTCTTTAGAACCATTAACCTGG + Intergenic
1200333278 X:155320151-155320173 TCTCTTTAGCACCAGTAGGCAGG - Intronic
1200548910 Y:4554104-4554126 TCTCTTCAGAGCCAGCAGGCAGG + Intergenic
1200623288 Y:5480598-5480620 TCTCTTCAGAGCCAGCAGGCAGG + Intronic
1201511598 Y:14770144-14770166 TCTCTTCAGAGCCAGCAGGCAGG - Intronic
1201705156 Y:16928587-16928609 TCTCTTCAGCACCCTCAGGCAGG - Intergenic