ID: 1200334630

View in Genome Browser
Species Human (GRCh38)
Location X:155336600-155336622
Sequence CTCTCACCAGAAGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2779
Summary {0: 32, 1: 295, 2: 685, 3: 875, 4: 892}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200334630_1200334634 -3 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334634 X:155336620-155336642 GAGCCTCAGGAAGGTAGAGTGGG No data
1200334630_1200334637 25 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334637 X:155336648-155336670 GCATCTCACATGATGAAAGTGGG No data
1200334630_1200334638 28 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG No data
1200334630_1200334633 -4 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334633 X:155336619-155336641 AGAGCCTCAGGAAGGTAGAGTGG No data
1200334630_1200334636 24 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334636 X:155336647-155336669 TGCATCTCACATGATGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200334630 Original CRISPR CTCTCACCAGAAGCAGATGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr