ID: 1200334635

View in Genome Browser
Species Human (GRCh38)
Location X:155336623-155336645
Sequence GCTCCCACTCTACCTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200334635_1200334639 19 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334639 X:155336665-155336687 AGTGGGAGGAAGAGAGAAAGTGG No data
1200334635_1200334644 26 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334644 X:155336672-155336694 GGAAGAGAGAAAGTGGTGGGGGG No data
1200334635_1200334637 2 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334637 X:155336648-155336670 GCATCTCACATGATGAAAGTGGG No data
1200334635_1200334642 24 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334642 X:155336670-155336692 GAGGAAGAGAGAAAGTGGTGGGG No data
1200334635_1200334643 25 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334643 X:155336671-155336693 AGGAAGAGAGAAAGTGGTGGGGG No data
1200334635_1200334641 23 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334641 X:155336669-155336691 GGAGGAAGAGAGAAAGTGGTGGG No data
1200334635_1200334636 1 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334636 X:155336647-155336669 TGCATCTCACATGATGAAAGTGG No data
1200334635_1200334638 5 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG No data
1200334635_1200334640 22 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334640 X:155336668-155336690 GGGAGGAAGAGAGAAAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200334635 Original CRISPR GCTCCCACTCTACCTTCCTG AGG (reversed) Intergenic
No off target data available for this crispr