ID: 1200334638

View in Genome Browser
Species Human (GRCh38)
Location X:155336651-155336673
Sequence TCTCACATGATGAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200334630_1200334638 28 Left 1200334630 X:155336600-155336622 CCAGCATCTGCTTCTGGTGAGAG 0: 32
1: 295
2: 685
3: 875
4: 892
Right 1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG No data
1200334635_1200334638 5 Left 1200334635 X:155336623-155336645 CCTCAGGAAGGTAGAGTGGGAGC No data
Right 1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200334638 Original CRISPR TCTCACATGATGAAAGTGGG AGG Intergenic
No off target data available for this crispr