ID: 1200337293

View in Genome Browser
Species Human (GRCh38)
Location X:155363678-155363700
Sequence GGCTTCTCAGGTGCTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200337293_1200337300 5 Left 1200337293 X:155363678-155363700 CCTGGTTGAGCACCTGAGAAGCC No data
Right 1200337300 X:155363706-155363728 TGAGAGTATGCTGAGGCAAGTGG No data
1200337293_1200337302 12 Left 1200337293 X:155363678-155363700 CCTGGTTGAGCACCTGAGAAGCC No data
Right 1200337302 X:155363713-155363735 ATGCTGAGGCAAGTGGTAGGAGG No data
1200337293_1200337297 -2 Left 1200337293 X:155363678-155363700 CCTGGTTGAGCACCTGAGAAGCC No data
Right 1200337297 X:155363699-155363721 CCCCGGTTGAGAGTATGCTGAGG No data
1200337293_1200337303 29 Left 1200337293 X:155363678-155363700 CCTGGTTGAGCACCTGAGAAGCC No data
Right 1200337303 X:155363730-155363752 AGGAGGTGCAGTTGTGAAGCAGG No data
1200337293_1200337301 9 Left 1200337293 X:155363678-155363700 CCTGGTTGAGCACCTGAGAAGCC No data
Right 1200337301 X:155363710-155363732 AGTATGCTGAGGCAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200337293 Original CRISPR GGCTTCTCAGGTGCTCAACC AGG (reversed) Intergenic
No off target data available for this crispr