ID: 1200339205

View in Genome Browser
Species Human (GRCh38)
Location X:155381619-155381641
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 3, 1: 0, 2: 2, 3: 20, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200339193_1200339205 23 Left 1200339193 X:155381573-155381595 CCTCAAGACCATGACTGCAGTGT 0: 3
1: 0
2: 0
3: 17
4: 160
Right 1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG 0: 3
1: 0
2: 2
3: 20
4: 210
1200339194_1200339205 15 Left 1200339194 X:155381581-155381603 CCATGACTGCAGTGTTGCGACAG 0: 3
1: 0
2: 2
3: 7
4: 96
Right 1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG 0: 3
1: 0
2: 2
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200339205 Original CRISPR CAACCGGGGTGGGGACGGAG AGG Intergenic
901956679 1:12790780-12790802 CAAGTGAGGTGGGGACTGAGCGG - Intergenic
901980063 1:13026927-13026949 CAAGTGAGGTGGGGACTGAGCGG - Intronic
902002023 1:13202004-13202026 CAAGTGAGGTGGGGACTGAGCGG + Intergenic
902021247 1:13347729-13347751 CAAGTGAGGTGGGGACTGAGCGG + Intergenic
902769302 1:18636537-18636559 CATCCGGGGTGCGCACCGAGGGG - Intronic
902867363 1:19288363-19288385 GAACAGGGGTGGGGGCGGTGGGG + Intronic
903347954 1:22699806-22699828 TGACGGGGGTGGGGGCGGAGGGG - Intergenic
903811829 1:26038964-26038986 CAGCCAGGGTGGGGACTCAGCGG - Exonic
903941948 1:26938091-26938113 CAACCAGGGTGGGGAGGGCTGGG - Intronic
904261271 1:29289063-29289085 CCACCTGGGTGGGGACAGAAAGG - Intronic
907446467 1:54511102-54511124 CAACATGGGTGGGGAGGGATGGG + Intergenic
911184033 1:94885984-94886006 CCACCGAGGTGGGGGTGGAGGGG + Intronic
914195973 1:145448369-145448391 CAACAGGGGTGGGGACGCCCAGG + Intergenic
914237464 1:145824563-145824585 GAGGCGGGGTGGGGACGGGGAGG + Intronic
922821409 1:228487925-228487947 GGACCGGGGCGGGGGCGGAGAGG - Intronic
924282889 1:242455910-242455932 GAGCCGGGGTGGGGACAGAAGGG + Intronic
1065024694 10:21528904-21528926 GAATGGGGGTGGGGATGGAGAGG + Intergenic
1065452334 10:25871824-25871846 CCAGTGGGGTGGGGATGGAGGGG + Intergenic
1065461159 10:25965908-25965930 CTACCGGGGTAGGGAAGGGGTGG + Intronic
1067898438 10:50211796-50211818 AAACTGGGGTGGGGACAGAGTGG - Intronic
1069873642 10:71548241-71548263 CATGCGGGGTGGAGACAGAGAGG + Intronic
1070257857 10:74826370-74826392 CCCCCGGGGTGGTGCCGGAGGGG + Intronic
1071496583 10:86171502-86171524 TAACCGAGGTGGGGACCCAGAGG + Intronic
1072625365 10:97107819-97107841 GAGCCGGGCTGGGGACAGAGAGG + Intronic
1072735943 10:97879845-97879867 GAAAGGGGGTGGGGACGGGGTGG + Intronic
1073054146 10:100688390-100688412 CAGCCAGGGTGGGGAGGCAGAGG + Intergenic
1076522115 10:131087822-131087844 TGGCCGGGGTGGGGACGGGGTGG + Intergenic
1077011681 11:381616-381638 CCCCGGGGTTGGGGACGGAGAGG - Intronic
1077446288 11:2592498-2592520 TGACCTGGGTGGGGAGGGAGGGG + Intronic
1077508408 11:2942769-2942791 CAAGCGGGGTGGGGTGGGTGGGG + Intergenic
1080366739 11:31582880-31582902 CAACTGTGGTGGGGGCGGGGTGG + Intronic
1083939607 11:65888560-65888582 CAGTCGGGGAGGGGACGGGGCGG + Intergenic
1084070003 11:66728006-66728028 CAGGCGGGGACGGGACGGAGAGG - Intronic
1084098784 11:66931430-66931452 CAACCGGGGAGGGAACATAGGGG + Intronic
1085795722 11:79537780-79537802 CAATCTGGGTAGGGACGAAGTGG - Intergenic
1087243030 11:95801820-95801842 CAAGCAGGGAGGAGACGGAGAGG + Intronic
1091597306 12:1886709-1886731 CAAAAGGGGTGTGGAAGGAGAGG + Intronic
1094762180 12:33546689-33546711 CTACTGGGGTGGGGAGGGAAGGG + Intergenic
1094847079 12:34366018-34366040 CATGCGCGGTGGGGACGGTGAGG + Intergenic
1096003691 12:48150981-48151003 CAAGCAGGGTGGGGACAGAAAGG + Intronic
1096633262 12:52943267-52943289 GAGCCGGGGTGTGGACTGAGAGG - Intronic
1096971812 12:55672494-55672516 CAATAGTGGTGGGGACAGAGAGG - Intergenic
1097729133 12:63107672-63107694 CAGCCGGGAAGGGGACTGAGAGG - Intergenic
1098978537 12:76930268-76930290 CAAGGGGGGTGGGAAAGGAGGGG + Intergenic
1101839335 12:108316626-108316648 CACCCGGTGTGGGCAGGGAGGGG + Intronic
1103905973 12:124327361-124327383 CACCGGGGGTGGGGACAGACGGG + Intronic
1103906580 12:124330780-124330802 GAGCAGGGGTGGGGAGGGAGCGG + Intronic
1104726781 12:131082698-131082720 CAAAAGGGGTGGGGAGGGAGAGG + Intronic
1104972079 12:132535392-132535414 CATCCGCTGTGGGGACGTAGAGG + Intronic
1106106161 13:26735337-26735359 GAAGCGGGGTGGGGATGAAGGGG - Intergenic
1106157592 13:27172070-27172092 CGCGCGGGGTGGGGACGGACCGG - Intergenic
1107135322 13:36938237-36938259 CAGCAGGGGTGGGGAGGGAAGGG - Intergenic
1108068579 13:46604264-46604286 TAACTGGGGTGGGGATGGTGAGG + Intronic
1112960005 13:105112589-105112611 CAAGTGGGGGGGGGGCGGAGGGG - Intergenic
1114880234 14:26775767-26775789 CAACATGGCTGGGGAGGGAGGGG - Intergenic
1116844598 14:49853480-49853502 CAATGGGGGTGGGGTGGGAGGGG + Intergenic
1117058834 14:51940171-51940193 GAAGAGGAGTGGGGACGGAGTGG + Intronic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1120549756 14:85855697-85855719 AAACCAGGGTGGGGGCGGTGGGG + Intergenic
1121447470 14:93988040-93988062 GAAGAGGGGTGGGGCCGGAGAGG + Intergenic
1121736321 14:96220610-96220632 TAAAGGGGGTGGGGAGGGAGGGG - Intronic
1121988016 14:98527537-98527559 CAACCAGTGTGGGTACAGAGAGG - Intergenic
1122177406 14:99931247-99931269 GATCTGGGGTGGGGAGGGAGGGG - Intronic
1122181003 14:99954496-99954518 CAACAGAGGTGGGGACACAGAGG - Intergenic
1122707388 14:103629631-103629653 GTACCGGGGTGGGAACGGAGAGG - Intronic
1123829358 15:24118245-24118267 CAACCTTGGTGGGAATGGAGTGG - Intergenic
1124642492 15:31404660-31404682 CAACAGGGATGGGGACCCAGTGG - Intronic
1124896952 15:33786098-33786120 CAACTGGGGTGGGCATGGGGAGG - Intronic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1127389166 15:58491527-58491549 AAACTGAGGTGGGGAAGGAGAGG - Intronic
1127838883 15:62812725-62812747 CAAACGAGGTGGGCATGGAGAGG - Intronic
1132153071 15:99475943-99475965 TATCTGGGGTGGGGAGGGAGGGG - Intergenic
1132657034 16:1045720-1045742 CAGGCCGGGTGGGGAGGGAGGGG + Intergenic
1132804521 16:1769394-1769416 CAGCTGGGGTGGGGACAGACAGG - Exonic
1133118088 16:3589589-3589611 CCCCCGGGGTGGGGACGGGAAGG + Exonic
1134314727 16:13108123-13108145 AAAGCAGGGTGGGGCCGGAGGGG - Intronic
1135533907 16:23277998-23278020 CAGGCAGGGTGGGGAGGGAGGGG + Intergenic
1136413718 16:30091402-30091424 CTCCCGGGGTGGGGAGGGAGGGG - Intronic
1141615291 16:85206665-85206687 CAGCCGGGGAGGGGACGGGCAGG - Intergenic
1141703348 16:85652302-85652324 CAACCGGGGTAGTGGGGGAGTGG - Intronic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1141883478 16:86875270-86875292 CAATTGGGGTGGGGTGGGAGTGG - Intergenic
1142994391 17:3752063-3752085 CATCCTGGGTGGCAACGGAGTGG - Intronic
1142994403 17:3752110-3752132 CATCCTGGGTGGCAACGGAGTGG - Intronic
1143104107 17:4519890-4519912 CAATCAGGGTAGGGACGGGGAGG - Intronic
1143563299 17:7707653-7707675 CAACGGGGCTGGTGATGGAGCGG + Intronic
1144643821 17:16954919-16954941 AAACTGGGGTGGGTAAGGAGAGG - Intronic
1144673131 17:17144123-17144145 CAACAGAGGTGCGGAAGGAGTGG + Intronic
1144952700 17:19002811-19002833 CAACAGGGGTGGAGAAGGGGAGG + Intronic
1145279571 17:21457812-21457834 CCACCGGGGTGAGGGCAGAGAGG - Intergenic
1146176559 17:30669117-30669139 AAACCGGGCTGGGGATGGGGTGG - Intergenic
1146350021 17:32085232-32085254 AAACCGGGCTGGGGATGGGGTGG - Intergenic
1148747720 17:49927789-49927811 GAGCCAGGGTGGGGACGGAGGGG - Intergenic
1151791241 17:76307352-76307374 GAGCGGTGGTGGGGACGGAGGGG - Intronic
1152228636 17:79103899-79103921 CAGCTGGGGTGGGGGCGGGGCGG + Intronic
1152380520 17:79940243-79940265 CAACCGATGTGGGGATAGAGAGG - Exonic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152552003 17:81034787-81034809 CAGCCGGGCTGGGGGCGGGGAGG - Intergenic
1152710401 17:81868279-81868301 CCACCGGGGAAGGGACGGGGAGG + Exonic
1157141415 18:45111011-45111033 AAACTGTGGTGGGGGCGGAGAGG - Intergenic
1158157617 18:54443330-54443352 TAACAGGGGCGGTGACGGAGGGG + Intergenic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1160777116 19:861459-861481 GAACCGGGATGGGGATGCAGGGG - Intronic
1160906464 19:1453797-1453819 CAGCCGGGCTGGGGAGGGGGAGG - Intronic
1161153909 19:2722555-2722577 CAACAGGAGAGGGGACTGAGTGG - Intronic
1161249181 19:3271178-3271200 CAACGGAGGTGGGGTGGGAGGGG + Intronic
1161308802 19:3582387-3582409 AAACTGGGGTGGGGAGTGAGGGG - Intergenic
1162747308 19:12806026-12806048 CAACGGGGGTGGGGAAGGCTTGG + Intronic
1163007582 19:14406309-14406331 CCTGCGGGGCGGGGACGGAGGGG - Exonic
1163255450 19:16153327-16153349 CTACTGGGGTGGGGCCGGAGGGG - Intronic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1163476209 19:17527401-17527423 CAGCCGGGGAGGGGACAGGGTGG + Intronic
1167357082 19:49010768-49010790 CAGCAGGGGTGGGGACGGAGCGG - Intronic
1168156654 19:54477010-54477032 CAAATGGGGTGGGCAGGGAGAGG + Intergenic
925078863 2:1044126-1044148 TAACCGGGGTGGGGGGGCAGCGG - Intronic
927222298 2:20724512-20724534 AAAGCGGGGTGGGGAGGAAGTGG + Intronic
928283391 2:29968029-29968051 CCAGCGGGGTGGTGACAGAGGGG + Intergenic
929510454 2:42562414-42562436 CAGCTGGGGTGGGGAGGGGGAGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
931728174 2:65130483-65130505 CCACGGGGGAGGGGGCGGAGAGG + Intergenic
934564805 2:95332531-95332553 AAACAGGTGAGGGGACGGAGAGG + Intronic
935106119 2:100045146-100045168 CAACAGAGGTGGGGAAGGGGAGG + Intronic
936009648 2:108917264-108917286 GAACAGAGGTGGGGAAGGAGGGG + Intronic
936557588 2:113509762-113509784 CATCTGGGGTGGGGGCGGCGGGG - Intergenic
938573766 2:132585453-132585475 GAAGCGGGGAGGGGACGGAAGGG - Intronic
938786031 2:134630694-134630716 CAACCTGGGTAGGGAGGGAGGGG - Intronic
946035704 2:216740559-216740581 CAACAGGGTGGGGGACGTAGGGG + Intergenic
948597350 2:239088484-239088506 CAGCAGGGGTCGGGACCGAGGGG - Intronic
1171400473 20:24870047-24870069 CACCAGGGCTGGGGACAGAGAGG - Intergenic
1171868201 20:30505975-30505997 GGTGCGGGGTGGGGACGGAGGGG - Intergenic
1172287799 20:33753312-33753334 CAACCCTGGTGGGAACGGTGTGG + Exonic
1173588790 20:44208111-44208133 CAAGAGGGGTGGGGGCGGGGGGG - Intronic
1173902487 20:46601119-46601141 AGATGGGGGTGGGGACGGAGTGG + Intronic
1176039120 20:63055128-63055150 CAACCCCAGTGGGGACTGAGAGG + Intergenic
1176241673 20:64078466-64078488 GACCCTGGGTGGGGACAGAGAGG - Intronic
1176551861 21:8226581-8226603 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1176570770 21:8409580-8409602 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1176578679 21:8453727-8453749 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1177840843 21:26232163-26232185 CACCTGGGGTTGGGACTGAGGGG + Intergenic
1179128311 21:38611797-38611819 GGACAGGGGTGGGCACGGAGTGG + Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1180033240 21:45226765-45226787 TAACAGGGGTGGGGACTGAGGGG - Intergenic
1180625162 22:17189527-17189549 CACGCGGGGTGGGGACTGGGGGG - Intronic
1181403468 22:22665793-22665815 TAACCAGGGTGGGGAAGGAGGGG - Intergenic
1181405781 22:22684223-22684245 TAACCAGGGTGGGGAGGGACGGG - Intergenic
1181408473 22:22701777-22701799 TAACCAGGGTGGGGAAGGAGTGG - Intergenic
1181413794 22:22745276-22745298 TAACCAGGATGGGGAGGGAGGGG - Intronic
1182024683 22:27108872-27108894 CAGCCAGGGTGGGGGCGGGGGGG - Intergenic
1182771930 22:32802231-32802253 CAGACGGGGTTGGGGCGGAGTGG + Intronic
1183411903 22:37659626-37659648 CCATCGGGGTGGGGTTGGAGAGG + Intronic
1185047678 22:48537199-48537221 CACCCGGGGTGGGGGCAGGGTGG + Intronic
1185186616 22:49404739-49404761 CAGCACGGGTGGGTACGGAGGGG + Intergenic
1185272516 22:49935654-49935676 GAGCAGGGGCGGGGACGGAGGGG + Intergenic
1185272620 22:49935893-49935915 GAGCAGGGGTGGGGGCGGAGGGG + Intergenic
1203256882 22_KI270733v1_random:143503-143525 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
950154239 3:10709655-10709677 CAACCCAGGTGGGGAAGGAGTGG - Intergenic
950345176 3:12287235-12287257 CAACATGGGTGGGGACGGAGTGG - Intergenic
955072875 3:55586136-55586158 CTGGCGGGGTGGGGAGGGAGTGG + Intronic
955772735 3:62402224-62402246 GAAACGGGGTGGGGGCGGGGGGG + Intronic
955948461 3:64218178-64218200 CACCTGGGGTGGGGAGGAAGTGG - Intronic
960007073 3:112791239-112791261 TAGCCGGGGTGGGGGCGGGGTGG + Intronic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
961081838 3:124034024-124034046 CAACTGGGGTGAAGGCGGAGGGG - Intergenic
961085909 3:124067313-124067335 CAACAGGGGTGGGTGCGGTGGGG - Intergenic
961739675 3:129025283-129025305 CATTAGGGGTCGGGACGGAGAGG + Intronic
962637871 3:137349284-137349306 CATCCGGGCTGGGCACGGAAAGG + Intergenic
962685076 3:137839833-137839855 CACCCGGGGTGGGGGTGGAGTGG + Intergenic
967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG + Exonic
969257329 4:6011282-6011304 TCACCGTGCTGGGGACGGAGTGG - Intergenic
969455613 4:7298117-7298139 CGACGGGGCTGGGGACAGAGGGG + Intronic
969592114 4:8127842-8127864 CACTCGGGGTGGGGGAGGAGTGG + Intronic
973867194 4:55125642-55125664 CATGCGGGGCGGGGCCGGAGCGG + Intergenic
976052337 4:81024128-81024150 CAACTGGGGTTGGGAGGAAGTGG - Intergenic
977758456 4:100701766-100701788 CAACAGGTGGGGGGACAGAGGGG - Intronic
979674693 4:123398409-123398431 CAACCGCGGCGGGGAGGGCGAGG - Intronic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
992195691 5:74336745-74336767 CAGCAGGGGTGGGGGCTGAGGGG + Intergenic
993094972 5:83471380-83471402 AAATGGGGGTGGGGAAGGAGTGG + Intergenic
996795597 5:127343354-127343376 AAACAGAGGTGGGGAGGGAGGGG - Intronic
996852381 5:127967068-127967090 CAACAGGCTTGGGGAAGGAGAGG + Intergenic
997593801 5:135092703-135092725 AGACCGGGGTGAGGAAGGAGAGG - Intronic
998092802 5:139380906-139380928 CAACAGGGGTGGGGAGGGGCGGG + Intronic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1006341879 6:33451839-33451861 CAGCCGGGGTGGGGGTGGTGGGG - Exonic
1007292306 6:40797059-40797081 CAGCCGGGGACGGGAAGGAGGGG - Intergenic
1007812199 6:44494457-44494479 CAACCGGGTTGGTGGCCGAGTGG + Intergenic
1011344724 6:86356248-86356270 CAACTGGGGTGGGAAAGGACAGG + Intergenic
1011612783 6:89169501-89169523 AAAAGGGGGTGGGGAGGGAGGGG - Intergenic
1014045347 6:116877683-116877705 CTACTGGGGTGGGGGCGGAGGGG - Intronic
1015309850 6:131754806-131754828 ATACAGGGGTGGGGACGGGGCGG - Intergenic
1017204092 6:151786335-151786357 AAACCGGGGTGGGGCAGGAGAGG - Intronic
1018801097 6:167222713-167222735 CATCCGGGCTGGGGAGGGATGGG - Intergenic
1018809036 6:167284458-167284480 CATCCGGGCTGGGGAGGGATGGG + Intronic
1019536650 7:1532929-1532951 CAGGGAGGGTGGGGACGGAGCGG - Intronic
1019912154 7:4107107-4107129 CATCCAGGGTGGGGAGGGTGGGG + Intronic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1026787100 7:73308634-73308656 AACCCGGGGTGGGGTCGGACGGG - Intronic
1029730587 7:102435409-102435431 ACACCGGGGAGGGGACAGAGCGG - Intronic
1029746255 7:102517283-102517305 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1029764193 7:102616262-102616284 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1032166955 7:129553005-129553027 CAATCAGTGTGGGGATGGAGAGG - Intergenic
1032167645 7:129558265-129558287 GAGCCGGGGTGGGGGCGGGGAGG - Intergenic
1032525600 7:132576797-132576819 CCGCGGGGGTGGGGACGAAGGGG - Exonic
1034263764 7:149772148-149772170 AAACCGGGGTGGGGGAGGAGAGG - Intronic
1035262670 7:157671661-157671683 CATGCGGGCTGGGGGCGGAGCGG + Intronic
1036167185 8:6446952-6446974 GCACCCTGGTGGGGACGGAGAGG + Intronic
1038931879 8:32202659-32202681 GAACGGGAGAGGGGACGGAGTGG + Intronic
1042611923 8:70608887-70608909 GGATGGGGGTGGGGACGGAGAGG - Intronic
1042680294 8:71376195-71376217 AAACTGGGGTGAGGAGGGAGTGG + Intergenic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1049280896 8:141743635-141743657 CAACAGGGGTGGTGACTGAGGGG + Intergenic
1049537577 8:143189507-143189529 CCACGGGGGTGGGGGCGGGGAGG - Intergenic
1049895418 9:107536-107558 CATCTGGGGTGGGGGCGGCGGGG + Intergenic
1050005083 9:1120901-1120923 CAACAGGGCAGGGGAGGGAGAGG + Intergenic
1054906786 9:70419729-70419751 CTGCGGGGGTGGGGAGGGAGTGG + Intergenic
1057279230 9:93698340-93698362 CAGCCGGGAGGGGGACAGAGTGG - Intergenic
1059451319 9:114372944-114372966 CAGCAGGTGTGGGGACGCAGCGG + Intronic
1060551595 9:124488043-124488065 CTGCAGGGGTGGGGACGGGGTGG - Intronic
1061196755 9:129110830-129110852 CAGGAGGGGCGGGGACGGAGGGG + Intronic
1061989928 9:134153318-134153340 AGCCCAGGGTGGGGACGGAGGGG + Intronic
1062021635 9:134322271-134322293 CAGCCGGGGTGGGGTTAGAGGGG + Intronic
1062698757 9:137888453-137888475 CAACAGGGGTGGGGACGCGCAGG - Intronic
1203473040 Un_GL000220v1:125185-125207 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1185509513 X:652570-652592 CAACTGGGGAGGTGTCGGAGAGG - Intronic
1189348330 X:40259118-40259140 CAAAAGGGGTGGGGCCGGCGAGG - Intergenic
1189855803 X:45223880-45223902 CCACCGGGGTGGTGTCAGAGAGG - Intergenic
1192456783 X:71282953-71282975 CAGACGGGGTGGGGGAGGAGGGG - Intergenic
1193325197 X:80172275-80172297 CTATGGGGGTGGGGACAGAGGGG - Intergenic
1197873627 X:131082810-131082832 CAACAGGAGAGGGGAGGGAGGGG - Intronic
1198212515 X:134529357-134529379 CAGCAGGGGTGGGGATGGTGGGG + Intergenic
1199473347 X:148219532-148219554 CGACAGGGGTGGGGAGTGAGGGG + Intergenic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200306104 X:155027180-155027202 CAAGCGGCGCGGGGACGGGGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic