ID: 1200349177

View in Genome Browser
Species Human (GRCh38)
Location X:155477549-155477571
Sequence GGCTTCTCAGGTGCTCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200349173_1200349177 -2 Left 1200349173 X:155477528-155477550 CCTCAGCATACTCTCAACCGGGG No data
Right 1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG No data
1200349170_1200349177 5 Left 1200349170 X:155477521-155477543 CCACTTGCCTCAGCATACTCTCA No data
Right 1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG No data
1200349168_1200349177 12 Left 1200349168 X:155477514-155477536 CCTCCTACCACTTGCCTCAGCAT No data
Right 1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG No data
1200349169_1200349177 9 Left 1200349169 X:155477517-155477539 CCTACCACTTGCCTCAGCATACT No data
Right 1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG No data
1200349167_1200349177 29 Left 1200349167 X:155477497-155477519 CCTGCTTCACAACTGCACCTCCT No data
Right 1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200349177 Original CRISPR GGCTTCTCAGGTGCTCAACC AGG Intergenic
No off target data available for this crispr