ID: 1200360778

View in Genome Browser
Species Human (GRCh38)
Location X:155604159-155604181
Sequence CTGAACATACCCATTGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200360775_1200360778 -10 Left 1200360775 X:155604146-155604168 CCCTACCTCGTGGCTGAACATAC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360770_1200360778 17 Left 1200360770 X:155604119-155604141 CCCTGGCTTGGGCCCACAGAACA 0: 2
1: 54
2: 68
3: 91
4: 296
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360773_1200360778 4 Left 1200360773 X:155604132-155604154 CCACAGAACAGCTGCCCTACCTC 0: 1
1: 0
2: 9
3: 47
4: 286
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360767_1200360778 28 Left 1200360767 X:155604108-155604130 CCAAGCAGGGCCCCTGGCTTGGG 0: 1
1: 2
2: 16
3: 61
4: 395
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360772_1200360778 5 Left 1200360772 X:155604131-155604153 CCCACAGAACAGCTGCCCTACCT 0: 1
1: 0
2: 4
3: 27
4: 208
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360771_1200360778 16 Left 1200360771 X:155604120-155604142 CCTGGCTTGGGCCCACAGAACAG 0: 2
1: 47
2: 91
3: 101
4: 298
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166
1200360769_1200360778 18 Left 1200360769 X:155604118-155604140 CCCCTGGCTTGGGCCCACAGAAC 0: 2
1: 33
2: 56
3: 99
4: 329
Right 1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG 0: 1
1: 1
2: 4
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200360778 Original CRISPR CTGAACATACCCATTGTCAG TGG Intronic
905947013 1:41911500-41911522 CTGAAAATGCCCATAGTCTGTGG + Intronic
906941350 1:50258327-50258349 CTTAACACACCCATTTACAGAGG + Intergenic
909806251 1:79876419-79876441 CTGAACATTCCCAGTGGCAGTGG + Intergenic
911147959 1:94570211-94570233 CTGAACAGTCCTATTTTCAGTGG + Intergenic
912614621 1:111085681-111085703 CTGAACATTCCCATTGGCAGTGG - Intergenic
915815766 1:158963096-158963118 CTGAACATTCCCAGTAGCAGCGG + Intronic
916268720 1:162918172-162918194 CTGAGCAGACCCATTGGTAGTGG - Intergenic
917003856 1:170389292-170389314 GTGAGCATACCCATTGGTAGTGG - Intergenic
923888716 1:238187274-238187296 CTGAACATGACCATTTCCAGGGG - Intergenic
924955829 1:248925797-248925819 GTGAACATTCCCATTGCCAGCGG + Intergenic
1064701186 10:18023534-18023556 ATGAACATTCCCATTGGCAGTGG - Intronic
1068086449 10:52379242-52379264 CTAAACATTCCCAGTGTCATAGG - Intergenic
1071023146 10:81082629-81082651 CTGAACATTCCCATTGGCAGTGG - Intergenic
1071023197 10:81082909-81082931 TTGAACATTCCCATTGGCAGTGG - Intergenic
1071399836 10:85258349-85258371 TAGAACATACCCATGGTCATGGG + Intergenic
1077818638 11:5713613-5713635 CTGCCCATTCCCATTGACAGAGG - Intronic
1077974840 11:7237279-7237301 GTGAACATACTAGTTGTCAGAGG + Intergenic
1078135148 11:8645674-8645696 CAGAGCATCCCCTTTGTCAGAGG - Intronic
1078606195 11:12777885-12777907 TTGAACATACGCATTGTGATAGG + Intronic
1079735740 11:23994581-23994603 TTGAACATCCCCACTGGCAGTGG + Intergenic
1080615248 11:33940020-33940042 CTGAATATTCCCAATGTCTGGGG + Intergenic
1083978673 11:66145748-66145770 CTGCACAGACCCATGGGCAGAGG + Intronic
1084274964 11:68046653-68046675 CCCAACATACACACTGTCAGGGG - Intronic
1085288739 11:75381891-75381913 CTGATCAAAACCCTTGTCAGTGG - Intergenic
1085980594 11:81719082-81719104 CTGAACCTACCCAGGGTCTGGGG + Intergenic
1086186478 11:84023071-84023093 CTGAAGATACCCATGGTCTTTGG + Intronic
1092077405 12:5685247-5685269 CTGAACCTGGCCATTCTCAGAGG + Intronic
1092579278 12:9820972-9820994 CTGACCATACCCACTGGTAGTGG + Intergenic
1093361312 12:18232397-18232419 CTGAACAGACCCATAATAAGTGG - Intronic
1093690247 12:22101934-22101956 CTGAACATATCCACTGGTAGTGG - Intronic
1094652923 12:32395058-32395080 CTGAAAATACACACTGTCACAGG - Intergenic
1098030665 12:66250172-66250194 CTGAAGAAAACCATTTTCAGAGG + Exonic
1098150308 12:67539547-67539569 CTGAGCACACCCTTCGTCAGGGG + Intergenic
1098632474 12:72740817-72740839 CTGAACATTCCCAGTAGCAGTGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102784788 12:115595668-115595690 CTGAACCCTCCCATGGTCAGTGG - Intergenic
1105559016 13:21473179-21473201 CTGGACATACCCTGGGTCAGAGG - Intergenic
1107175618 13:37395065-37395087 CTGAGCATACCCACTGCTAGTGG + Intergenic
1107187957 13:37546560-37546582 CTGAACATTCCCACTGCTAGTGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112617563 13:101020825-101020847 CTGAACACACCCATGGCCAGTGG - Intergenic
1113988675 13:114340929-114340951 GTGAACATTCCCATTGCCAGTGG + Intergenic
1114278640 14:21169933-21169955 CTGATTATACCCATTGGAAGTGG + Intergenic
1114988836 14:28263029-28263051 CTGAGCATACCCACTGATAGTGG + Intergenic
1119145344 14:72308483-72308505 CTGAGCATACCGATTTTTAGTGG - Intronic
1119299829 14:73562868-73562890 CTGAACACAACCCTTATCAGTGG + Intergenic
1121355959 14:93215192-93215214 CTGAAAATCCCCACTCTCAGGGG - Exonic
1123645825 15:22437080-22437102 CTTAACATAAACATTGACAGCGG - Intergenic
1124406952 15:29401619-29401641 CTGTACATACCCATACTCAATGG + Intronic
1126195272 15:45923925-45923947 CTGCAGATCCCCATTGTCTGGGG + Intergenic
1129880605 15:79004002-79004024 CTGAACATCCCCATCATCACTGG - Exonic
1130260172 15:82348518-82348540 CTTAACATAGACATTGACAGTGG - Intronic
1130268559 15:82430915-82430937 CTTAACATAGACATTGACAGTGG + Intronic
1130281061 15:82520489-82520511 CTCAACATAGACATTGACAGTGG + Intergenic
1130472432 15:84236670-84236692 CTTAACATAGACATTGACAGTGG + Intronic
1130479923 15:84351241-84351263 CTTAACATAGACATTGACAGTGG + Intergenic
1130491847 15:84436888-84436910 CTTAACATAGACATTGACAGTGG - Intergenic
1130503461 15:84515928-84515950 CTTAACATAGACATTGACAGTGG - Intergenic
1130594729 15:85241306-85241328 CTCAACATAGACATTGACAGTGG + Intergenic
1132433826 15:101781167-101781189 CTTAACATAGACATTGACAGTGG - Intergenic
1134246100 16:12541285-12541307 CTGACCATCCCCACTGTTAGTGG - Intronic
1138997415 16:62472478-62472500 CTGAGCATATCCATTGATAGTGG - Intergenic
1139061901 16:63263304-63263326 CTGAACATTCCCATTACCCGAGG - Intergenic
1141396944 16:83713571-83713593 ATGAACATACCATTTGTGAGAGG - Intronic
1141946655 16:87315370-87315392 TTGTACATGCCCATTTTCAGAGG - Intronic
1142316848 16:89352735-89352757 CTGAGCACACACATTTTCAGAGG - Intronic
1143172310 17:4937441-4937463 CAGAAGATCCCCTTTGTCAGTGG - Exonic
1144530330 17:16032438-16032460 CTGAGCATCCGCATAGTCAGAGG + Exonic
1145718966 17:27050207-27050229 CTGAAGATTCTCATTGGCAGTGG + Intergenic
1150662296 17:67093522-67093544 CAGAACATTCCCATCGTCACAGG - Intronic
1154470178 18:14693155-14693177 CTGAACATTCTCATTGGCAGTGG - Intergenic
1155768973 18:29672800-29672822 CTGAACATTCCTATTGGCAGTGG + Intergenic
1155912794 18:31523932-31523954 CTGAACAGAACCATAGTAAGGGG + Intronic
1156766801 18:40666303-40666325 TTGAACATATCCAGTGTTAGGGG + Intergenic
1160606243 18:80051926-80051948 CTGAACAGACCAATAGTGAGTGG + Intronic
1166586663 19:43954913-43954935 GTGCTCATACCCAATGTCAGTGG - Intronic
1167771880 19:51525798-51525820 ATGAACGTTCCCATTGGCAGTGG + Intronic
924959114 2:17911-17933 GTGAACATTCCCATTGCCAGCGG - Intergenic
930599109 2:53423676-53423698 ATGAACATTTCCATTGGCAGTGG - Intergenic
933187030 2:79290242-79290264 ATCAACATACCCAATGTTAGGGG - Intronic
935618060 2:105105559-105105581 CTGAACACACTCAATGTCTGTGG - Intergenic
938418290 2:131122881-131122903 CTCAACGTCCCCATGGTCAGGGG + Intronic
940482891 2:154257789-154257811 ATGAGCATAACCTTTGTCAGAGG + Intronic
940707879 2:157126696-157126718 CTGAACATTCCCAGTAGCAGTGG + Intergenic
946845294 2:223853591-223853613 CTGAACCTACACATGGTCATAGG - Intergenic
1174929109 20:54794009-54794031 CTGAACATTCCCAGTAGCAGAGG - Intergenic
1176688818 21:9880294-9880316 CTGAAAATGCCCAGTGGCAGTGG - Intergenic
1176688863 21:9880585-9880607 CTGAACATTTCTATTGCCAGTGG - Intergenic
1176804318 21:13464710-13464732 CTGAACATTCTCATTGGCAGTGG + Intergenic
1177450494 21:21259123-21259145 CTGCACATCCTCATTTTCAGGGG - Intronic
1179370908 21:40805397-40805419 CTGAACACACCAAAAGTCAGAGG - Intronic
949436869 3:4038806-4038828 CTGAGCATACCCAGTGGTAGTGG - Intronic
949924327 3:9028920-9028942 CTGATGATGCCCATTTTCAGGGG + Intronic
950884765 3:16353589-16353611 CTCAACATACGCATTGTGGGAGG - Intronic
951168152 3:19507056-19507078 CTGAACATTTCCAGTGGCAGGGG - Intronic
951268919 3:20602176-20602198 CTGAACATTCCCATTGGCAATGG - Intergenic
957557263 3:81778825-81778847 CTCAACAAACCCAAGGTCAGAGG - Intergenic
958594313 3:96201679-96201701 CTGAACATTCTCATTGGCAGTGG + Intergenic
958838393 3:99172633-99172655 CTGAACATTCCCAGTAGCAGTGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961136788 3:124518882-124518904 CTGAACATTTCTATTATCAGTGG + Exonic
962307190 3:134299379-134299401 CTGCACACACCCAATTTCAGAGG - Intergenic
964251030 3:154717566-154717588 TTGAACATAACTCTTGTCAGTGG + Intergenic
965113071 3:164451764-164451786 CTGAACATTCCCAGTAGCAGTGG - Intergenic
965412190 3:168345959-168345981 TTGAACTTAACTATTGTCAGGGG + Intergenic
966152293 3:176877793-176877815 CTGAGCATACCCACTGGTAGTGG + Intergenic
966500468 3:180633891-180633913 CTGAGCATACCCACTGGTAGTGG + Intronic
970640831 4:18064222-18064244 CTTAAGATACACATTGTCATAGG + Intergenic
972125613 4:35761103-35761125 CTGCACATTATCATTGTCAGGGG + Intergenic
976695410 4:87914893-87914915 CTGGATAAACCCATTGTAAGTGG + Intergenic
977979491 4:103306053-103306075 CTGAACATTTCCATTAACAGTGG - Intergenic
977979632 4:103306999-103307021 CTGAACATTCCCACTGGCAGCGG - Intergenic
978686661 4:111453298-111453320 CAGAACATACCCATTCTCTATGG + Intergenic
979758711 4:124373817-124373839 CTGAACATTCCCTTTGGCAGTGG - Intergenic
980352205 4:131698108-131698130 CTGAAAATGCCCAGTGGCAGTGG - Intergenic
980352247 4:131698399-131698421 CTGAACATTTCTATTGCCAGTGG - Intergenic
981337321 4:143581782-143581804 CTGAACATTTCCATTGGCAGTGG + Intronic
981398717 4:144286131-144286153 CTGACCAGACCCATTGTCCATGG - Intergenic
983547647 4:168979753-168979775 CTGAATATTCCCATTCGCAGTGG + Intronic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984790932 4:183614115-183614137 CTAAACACAGGCATTGTCAGAGG + Intergenic
985468506 5:20913-20935 GTGAACAGTCCCATTGCCAGCGG - Intergenic
988207104 5:28152968-28152990 CTGAAGATCCCCTTTGTAAGGGG + Intergenic
988608340 5:32702126-32702148 CTGAACCTACCCAGGGGCAGGGG - Intronic
990012795 5:51020774-51020796 CTGAACATACTCATTTTTTGGGG + Intergenic
992626471 5:78640328-78640350 CCAAACATACCCATTATAAGGGG + Intronic
993138713 5:84002953-84002975 CTGAACATTTCCACTGACAGAGG + Intronic
993246451 5:85458991-85459013 GTGAACATTCTCATTGGCAGTGG - Intergenic
993246503 5:85459269-85459291 CTGAACATTCCCATTGGCAGTGG - Intergenic
993634401 5:90326437-90326459 CTGACCATTCCCACTGTTAGTGG - Intergenic
994729490 5:103475311-103475333 CTGAACATACCCTTGGCAAGTGG + Intergenic
998375635 5:141688810-141688832 CTGCACAGACCCATTTACAGGGG + Intergenic
999479424 5:151933195-151933217 CTGCACATACACGTGGTCAGAGG - Intergenic
1001502782 5:172251595-172251617 TTGAACATACCCACTGTCTCTGG - Intronic
1002059543 5:176618456-176618478 CTGAGCAGAACCATTCTCAGTGG + Intergenic
1002755575 6:156413-156435 GTGAACAGTCCCATTGCCAGCGG - Intergenic
1008282716 6:49615272-49615294 CTAAACAGAGACATTGTCAGTGG - Intronic
1009946453 6:70347087-70347109 CTGAATACTCCCATTGGCAGTGG - Intergenic
1010832426 6:80547151-80547173 CAGAACAGCCCCATTGTCACTGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014428310 6:121335535-121335557 CTGGACATAACCATGGTCTGGGG - Intergenic
1015933213 6:138382989-138383011 CTGAAGTGCCCCATTGTCAGAGG - Exonic
1016315912 6:142786714-142786736 TTAAAAATACCCATTGTTAGTGG + Intronic
1020390557 7:7653561-7653583 GTGATCATACCCATTCACAGAGG + Intronic
1022452129 7:30525385-30525407 CTTAACATAGACATTGACAGTGG - Intronic
1025190796 7:56894205-56894227 CTGAAAAGACCCCCTGTCAGAGG + Intergenic
1025681147 7:63682719-63682741 CTGAAAAGACCCCCTGTCAGAGG - Intergenic
1026470162 7:70688226-70688248 CTCAACATACCCATGATGAGAGG - Intronic
1028477903 7:91271236-91271258 TTTAACATATCCATTGTCAAAGG - Exonic
1032903012 7:136332532-136332554 CTGAAAATATACATTCTCAGAGG - Intergenic
1035234217 7:157485749-157485771 CTGAGCCCACCCATGGTCAGCGG - Intergenic
1041188111 8:55323643-55323665 CTGCACATACACATTTACAGAGG - Intronic
1045001117 8:97879121-97879143 GACAACAAACCCATTGTCAGGGG + Intronic
1046486410 8:114894329-114894351 CTGAACACTCCCAGTGGCAGGGG - Intergenic
1046487889 8:114909949-114909971 CTGAACATTCCCACTGGTAGTGG + Intergenic
1046975086 8:120265984-120266006 CTAAACATAGCCATTCACAGAGG - Intronic
1050019152 9:1266069-1266091 CTAAAAATGCCCATTGTAAGAGG + Intergenic
1050457852 9:5850572-5850594 CTGAAAATGCTCACTGTCAGTGG + Intergenic
1051163229 9:14232319-14232341 CTGAACATTCCCAGTGTGACGGG - Intronic
1052897322 9:33759905-33759927 CTGAACAAGCCCACTGGCAGTGG + Intronic
1053425626 9:38008199-38008221 CTGAACGTGCTCAGTGTCAGGGG + Intronic
1053780464 9:41601315-41601337 CTGAACATTTCTATTGCCAGTGG + Intergenic
1053780507 9:41601606-41601628 CTGAAAATGCCCAGTGGCAGTGG + Intergenic
1054168406 9:61811472-61811494 CTGAACATTTCTATTGCCAGTGG + Intergenic
1054168450 9:61811763-61811785 CTGAAAATGCCCAGTGGCAGTGG + Intergenic
1054669079 9:67769055-67769077 CTGAAAATGCCCAGTGGCAGTGG - Intergenic
1054669123 9:67769346-67769368 CTGAACATTTCTATTGCCAGTGG - Intergenic
1056293917 9:85172616-85172638 CCACACTTACCCATTGTCAGAGG - Intergenic
1058089011 9:100782659-100782681 CTGAACTTACCCATTTCCATTGG + Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061543892 9:131292665-131292687 CTCAACTTACCCACAGTCAGTGG + Intronic
1186497301 X:10021831-10021853 CAGAACATACCCATTGGCTGTGG - Intronic
1186575216 X:10758393-10758415 CTGAAAAAACTCTTTGTCAGTGG - Intronic
1188717378 X:33476719-33476741 CTGAACATTCCCGTTTGCAGTGG + Intergenic
1191019178 X:55841869-55841891 CTGAGCATACCCACTGGTAGTGG - Intergenic
1191123040 X:56925956-56925978 CTGAGCATGCCCACTGGCAGTGG - Intergenic
1192691759 X:73372640-73372662 CTGAGCATACCCACTGGTAGTGG - Intergenic
1192756310 X:74049771-74049793 CTGAACATTTCCATTGGCAGTGG + Intergenic
1192865926 X:75132087-75132109 CTGAACATTCCCATTGTTAGTGG + Intronic
1193067616 X:77275957-77275979 CTGAACATTCCTATTGGCAGAGG + Intergenic
1193317051 X:80076772-80076794 CTGAACATTCCCAGTAGCAGTGG - Intergenic
1193425482 X:81337044-81337066 CTGAACATTCCCAGTAGCAGTGG - Intergenic
1193513392 X:82433346-82433368 CTGAATATTCTCATTGGCAGTGG + Intergenic
1194040696 X:88938640-88938662 CTAAACATTCCCATTGGAAGTGG - Intergenic
1194201591 X:90958553-90958575 CTGAGCATACCCACTGGTAGTGG + Intergenic
1194899973 X:99497944-99497966 CTGAACATTCCCATTAGCAGTGG + Intergenic
1196496425 X:116329232-116329254 CTGAAAATTCCCATTGGCAGTGG + Intergenic
1197623908 X:128781593-128781615 CTGAACATACCCATTGGCAGTGG + Intergenic
1197904675 X:131412352-131412374 CTGAGCATACCCACTGGTAGTGG + Intergenic
1199399104 X:147376396-147376418 CTGATCATTCTAATTGTCAGTGG - Intergenic
1199546796 X:149014488-149014510 TAGAAAATTCCCATTGTCAGGGG + Intergenic
1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG + Intronic
1200547431 Y:4534008-4534030 CTGAGCATACCCACTGGTAGTGG + Intergenic