ID: 1200369896

View in Genome Browser
Species Human (GRCh38)
Location X:155714584-155714606
Sequence CAGCACAGTTCCTCTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200369896_1200369904 19 Left 1200369896 X:155714584-155714606 CCACCACTAGAGGAACTGTGCTG No data
Right 1200369904 X:155714626-155714648 ACAGCACTGGGCCTTACCCAAGG No data
1200369896_1200369900 6 Left 1200369896 X:155714584-155714606 CCACCACTAGAGGAACTGTGCTG No data
Right 1200369900 X:155714613-155714635 ACCTGAAGCCAGAACAGCACTGG No data
1200369896_1200369902 7 Left 1200369896 X:155714584-155714606 CCACCACTAGAGGAACTGTGCTG No data
Right 1200369902 X:155714614-155714636 CCTGAAGCCAGAACAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200369896 Original CRISPR CAGCACAGTTCCTCTAGTGG TGG (reversed) Intergenic
No off target data available for this crispr