ID: 1200372769

View in Genome Browser
Species Human (GRCh38)
Location X:155744467-155744489
Sequence TAAGATTCTAGGATTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200372769_1200372773 2 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372773 X:155744492-155744514 GTGTGGTGTCGGTTTCACTTCGG No data
1200372769_1200372774 13 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372774 X:155744503-155744525 GTTTCACTTCGGATTCCAAACGG No data
1200372769_1200372777 19 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372777 X:155744509-155744531 CTTCGGATTCCAAACGGGAAGGG No data
1200372769_1200372772 -9 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372772 X:155744481-155744503 AGAATCTTAAAGTGTGGTGTCGG No data
1200372769_1200372776 18 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372776 X:155744508-155744530 ACTTCGGATTCCAAACGGGAAGG No data
1200372769_1200372775 14 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372775 X:155744504-155744526 TTTCACTTCGGATTCCAAACGGG No data
1200372769_1200372779 30 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372779 X:155744520-155744542 AAACGGGAAGGGACTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200372769 Original CRISPR TAAGATTCTAGGATTGTTGC AGG (reversed) Intergenic