ID: 1200372771

View in Genome Browser
Species Human (GRCh38)
Location X:155744478-155744500
Sequence ACACCACACTTTAAGATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200372771_1200372775 3 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372775 X:155744504-155744526 TTTCACTTCGGATTCCAAACGGG No data
1200372771_1200372779 19 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372779 X:155744520-155744542 AAACGGGAAGGGACTTTTCCTGG No data
1200372771_1200372773 -9 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372773 X:155744492-155744514 GTGTGGTGTCGGTTTCACTTCGG No data
1200372771_1200372774 2 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372774 X:155744503-155744525 GTTTCACTTCGGATTCCAAACGG No data
1200372771_1200372777 8 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372777 X:155744509-155744531 CTTCGGATTCCAAACGGGAAGGG No data
1200372771_1200372776 7 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372776 X:155744508-155744530 ACTTCGGATTCCAAACGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200372771 Original CRISPR ACACCACACTTTAAGATTCT AGG (reversed) Intergenic