ID: 1200372779

View in Genome Browser
Species Human (GRCh38)
Location X:155744520-155744542
Sequence AAACGGGAAGGGACTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200372769_1200372779 30 Left 1200372769 X:155744467-155744489 CCTGCAACAATCCTAGAATCTTA No data
Right 1200372779 X:155744520-155744542 AAACGGGAAGGGACTTTTCCTGG No data
1200372771_1200372779 19 Left 1200372771 X:155744478-155744500 CCTAGAATCTTAAAGTGTGGTGT No data
Right 1200372779 X:155744520-155744542 AAACGGGAAGGGACTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200372779 Original CRISPR AAACGGGAAGGGACTTTTCC TGG Intergenic