ID: 1200375889

View in Genome Browser
Species Human (GRCh38)
Location X:155779829-155779851
Sequence ACAATGATCTATAGGACACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200375889_1200375892 10 Left 1200375889 X:155779829-155779851 CCCTGTGTCCTATAGATCATTGT 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1200375892 X:155779862-155779884 AAAAGCATTAGTGCCCCATTTGG 0: 1
1: 1
2: 0
3: 9
4: 113
1200375889_1200375893 18 Left 1200375889 X:155779829-155779851 CCCTGTGTCCTATAGATCATTGT 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1200375893 X:155779870-155779892 TAGTGCCCCATTTGGACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 61
1200375889_1200375897 25 Left 1200375889 X:155779829-155779851 CCCTGTGTCCTATAGATCATTGT 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1200375897 X:155779877-155779899 CCATTTGGACCTTTGGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200375889 Original CRISPR ACAATGATCTATAGGACACA GGG (reversed) Exonic
900867861 1:5281329-5281351 ACAATGGTATAAAGCACACAGGG + Intergenic
904111042 1:28126339-28126361 TCAATGAGCTATAGTACATAAGG - Intergenic
905102222 1:35534308-35534330 AGAATGATCTTTAGGAAAAATGG - Intronic
906776838 1:48537435-48537457 ACACGGATCTAAAGGACATAGGG - Intronic
908887798 1:68810223-68810245 ACTAAAATCTATAGGACACCAGG + Intergenic
910493995 1:87805639-87805661 ACAAAGACCAAAAGGACACAAGG - Intergenic
911424575 1:97692317-97692339 AAAATGTTCTATAGATCACATGG - Intronic
911508290 1:98781696-98781718 ACAATGATCTCTGAGAGACAGGG + Intergenic
916238056 1:162610581-162610603 AAAATGATCTATAGATGACAAGG + Intergenic
918699586 1:187591133-187591155 ACAATTATTTTTAGGACACTAGG - Intergenic
919017552 1:192059547-192059569 ACAATGAAGAAAAGGACACATGG + Intergenic
919192326 1:194238214-194238236 CAAATGATCTATTGTACACATGG + Intergenic
921164160 1:212494159-212494181 TAAATAATCTGTAGGACACATGG + Intergenic
922035855 1:221847071-221847093 ACCATGATATATAGGAACCAAGG + Intergenic
922379315 1:225006334-225006356 ACAATGATTTTCAGGAAACAAGG + Intronic
924374887 1:243395573-243395595 AGAATGATTTATATGACACTGGG + Intronic
1064243645 10:13652606-13652628 TTAATGATCTAAAGGACAAAGGG + Intronic
1067978001 10:51047958-51047980 ACCATGATCTACAGGGCATAAGG + Intronic
1068985355 10:63103223-63103245 AGAATGAAGCATAGGACACAGGG - Intergenic
1072342235 10:94463734-94463756 ACACTGCTCTAAAGTACACAAGG - Intronic
1073265062 10:102222510-102222532 ATATTCTTCTATAGGACACAAGG - Intergenic
1074964961 10:118482741-118482763 ACAAAGACCAGTAGGACACAAGG + Intergenic
1078733639 11:13999864-13999886 ACAAAGGACTATAGGACATAAGG - Intronic
1079470982 11:20777181-20777203 ATAATGTTCTAAAGGACACTGGG - Intronic
1079498837 11:21077992-21078014 ACATTCATCTGTAGAACACAAGG + Intronic
1080427328 11:32168253-32168275 ACAATCTTGTATAGGAAACAGGG + Intergenic
1081152967 11:39654264-39654286 ACAATGATCTATATAATATAAGG + Intergenic
1082171401 11:49009828-49009850 ACAAAGATCTAAAGTACAAAAGG + Intergenic
1082911220 11:58376504-58376526 ACAATGATCTTAAGGAAACTTGG + Intergenic
1084345758 11:68547378-68547400 ACAAGGCTGTATGGGACACAGGG + Intronic
1086185644 11:84012264-84012286 ACAATGATCTGGAGTACATAAGG - Intronic
1086350063 11:85935808-85935830 ACACGGCGCTATAGGACACATGG - Intergenic
1086694493 11:89827263-89827285 ACAAAGATCTAAAGTACAAAAGG - Intergenic
1086711652 11:90017248-90017270 ACAAAGATCTAAAGTACAAAAGG + Intergenic
1089897461 11:121945688-121945710 GCAATCTTCTATAGGACCCATGG - Intergenic
1091363968 11:135001619-135001641 CCAGGGATCTATAGGGCACATGG + Intergenic
1093260648 12:16933316-16933338 ACAAGGAGCAATGGGACACAAGG - Intergenic
1094766390 12:33600005-33600027 ATAAAGATCTATTAGACACAGGG - Intergenic
1098613319 12:72488700-72488722 ACATTCTTCTCTAGGACACATGG + Intronic
1104830730 12:131749536-131749558 ACTACCAACTATAGGACACAGGG - Intronic
1105534775 13:21255435-21255457 AGAATTATGTATTGGACACAGGG + Intergenic
1106652500 13:31706669-31706691 AAAATGATCTGTAGGGTACAGGG + Intergenic
1107895986 13:44964375-44964397 ACGATGGTCTCTATGACACAGGG + Intronic
1108190294 13:47931507-47931529 ACAATGATCAATAGGAGACATGG - Intergenic
1109277131 13:60315384-60315406 AAAATGATACATAGGACCCATGG - Intergenic
1109592049 13:64498255-64498277 ACAATGAACTATTATACACAGGG + Intergenic
1109938751 13:69330457-69330479 AGAATGATCAATAGAAGACATGG - Intergenic
1110649724 13:77929281-77929303 ACAGTCATCTATAGGACATAGGG + Intergenic
1111838181 13:93414904-93414926 ACAATGAACAAAAGAACACAAGG + Intronic
1114186275 14:20404763-20404785 ACAAAGATGCCTAGGACACAGGG + Exonic
1114769016 14:25407956-25407978 GCAATGATCTGAAGGACATAAGG + Intergenic
1115921311 14:38377466-38377488 AGAATGACCTATAGACCACAGGG + Intergenic
1117864982 14:60137640-60137662 ATAATGAGCTATACAACACAGGG + Exonic
1119249841 14:73142421-73142443 ACCATGATCTCTAGCACAAAGGG - Intronic
1121336409 14:93080148-93080170 ATAATTATCTACAGCACACAGGG - Intronic
1125846967 15:42864971-42864993 ACAATGATATAAAGGACAGGAGG + Intronic
1126840648 15:52714546-52714568 ACTATGATATATAGGGCTCAGGG + Intergenic
1129950532 15:79585807-79585829 CCAATTTTCCATAGGACACAAGG - Intergenic
1132306217 15:100815054-100815076 ACATTTATTTATAGGACACCAGG - Intergenic
1134664238 16:16007030-16007052 AGAGTGATCTAGATGACACAGGG + Intronic
1136049144 16:27638257-27638279 ACAAGAAGCTATAGGACTCATGG - Intronic
1137281366 16:46979562-46979584 ACAGTGATCTAGAGGAAGCAGGG + Intergenic
1142998975 17:3778852-3778874 ACAGTGATCTCTAGAAAACATGG + Intronic
1143025133 17:3937208-3937230 ACCATGATCCATAGGTCACCAGG + Intronic
1143346559 17:6253813-6253835 ACAATGCTCTCTAGGACAGATGG + Intergenic
1144297586 17:13891576-13891598 ACAATGATCTCTATAAGACAAGG + Intergenic
1144784134 17:17822605-17822627 AGAATGCTCTACAGGACCCATGG + Intronic
1150596426 17:66609958-66609980 ACACTGAACTATAGGACACCCGG - Intronic
1152314493 17:79572366-79572388 ACAATGAGCTCCTGGACACAGGG - Intergenic
1153139175 18:1953078-1953100 ACTATGTTCTAAAGGCCACAGGG - Intergenic
1155235771 18:23817147-23817169 ACAATGAACTATAGGAGCGAGGG + Intronic
1159968375 18:74619292-74619314 CCAATAAGCTGTAGGACACAGGG - Intronic
1159987415 18:74859773-74859795 ACAAAGATAAATAGGACACAGGG - Intronic
1164982848 19:32627286-32627308 ACAACGATCTCTGGGAGACAGGG + Intronic
924980598 2:216669-216691 CTAATGATCTATAAGACACCTGG + Intergenic
925087533 2:1120952-1120974 ACATTTTTCTATAGCACACATGG + Intronic
925452108 2:3978146-3978168 AGAATGATCCATAGGGCATAGGG + Intergenic
929627602 2:43425672-43425694 ACACTGTTCTATAACACACATGG + Intronic
931115320 2:59160300-59160322 ACAATGATGTAGAGGACAATAGG + Intergenic
933284148 2:80366504-80366526 AAGATGATCTGTAGGACACCAGG - Intronic
933620778 2:84538539-84538561 ACACTGAGGTATAGGAGACATGG - Intronic
936380408 2:111980331-111980353 TCAAATATCCATAGGACACAGGG - Intronic
938993441 2:136653216-136653238 ACAATGATGAATACGACATATGG + Intergenic
939140008 2:138343739-138343761 ACAATCATCTATAGGAGAAGTGG + Intergenic
939566078 2:143788090-143788112 AAAATGATCAAGAAGACACATGG + Intergenic
940973451 2:159918960-159918982 CCAATGATCTATAGCACAGATGG + Intergenic
942668475 2:178348059-178348081 CCAAGGATTTAGAGGACACATGG - Intronic
944198577 2:197081368-197081390 AGAATGATATTTAGGACACCAGG + Intronic
946507485 2:220317334-220317356 TCAAAGATCTGTAGGACTCAGGG + Intergenic
946802511 2:223435160-223435182 ACAATTAGTTCTAGGACACAAGG + Intergenic
1169053699 20:2601961-2601983 ATAATTATCCATAGGGCACAGGG + Intronic
1170475582 20:16711022-16711044 ACAGTGATCTAGAGGGCTCAAGG + Intergenic
1177915720 21:27085975-27085997 AAAATAATCTCTAGGGCACAAGG - Intergenic
1182405914 22:30130119-30130141 CCAATGATCTATAGTAAAGAAGG + Intronic
949368519 3:3309158-3309180 AAGGTGAACTATAGGACACAAGG + Intergenic
949975052 3:9449005-9449027 ACAGTGTTCTAGAGGACCCAGGG - Intronic
950953712 3:17028817-17028839 GCAATGTTGCATAGGACACATGG - Intronic
951293569 3:20904105-20904127 ACAATGATAAATATGACATAGGG + Intergenic
951722352 3:25713663-25713685 ACTATATTCTATTGGACACATGG + Intergenic
953293229 3:41687479-41687501 ACAAAGATCTTTAAGGCACAAGG + Intronic
955036657 3:55274545-55274567 ACAATAATGAATAGGACAAAAGG - Intergenic
957429060 3:80077932-80077954 TCAATGTTCTATAGGATTCATGG - Intergenic
958655853 3:97003068-97003090 ACAATGATCATTTGGACATAGGG + Intronic
958736148 3:98011410-98011432 ACCAGAAGCTATAGGACACATGG - Intronic
959887961 3:111524427-111524449 ACACTGATTTTTAGGAAACAGGG + Intronic
962169514 3:133086197-133086219 TCAATGATGGATAGGTCACAAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964558154 3:157963884-157963906 ACAATGAAGTTTAGGAAACATGG - Intergenic
971213653 4:24643799-24643821 AAAATGATCCATAGGAACCATGG - Intergenic
971644699 4:29183729-29183751 ACAGTCTTCTATAGGACAGACGG + Intergenic
971862691 4:32128376-32128398 ACAATTCTCTATGGGAGACAAGG + Intergenic
975519903 4:75289548-75289570 ACTATGATCTATAGAGCACATGG - Intergenic
976932294 4:90582715-90582737 GCAATAATCTGTAGGAGACATGG + Intronic
978225926 4:106334961-106334983 ACAATGATCTATAAGACATTTGG - Intronic
978993264 4:115114300-115114322 ACAATGAGCAATAGGAAACTCGG + Intergenic
984420362 4:179513557-179513579 TCAAAGAACTATAGGACACAAGG + Intergenic
985422162 4:189795238-189795260 AGAATGTTCTAGAGCACACACGG + Intergenic
986343204 5:6810551-6810573 ACAATGTCCCATAGAACACAGGG + Intergenic
987813307 5:22868098-22868120 ACATTTTTCTATAGGACAGAAGG + Intergenic
988638273 5:33011553-33011575 ACAATGACCTGAGGGACACAAGG + Intergenic
988713669 5:33803546-33803568 ACAATGATCTCTATGATTCATGG + Intronic
989722443 5:44545530-44545552 AGAATGATCTATATTCCACAGGG - Intergenic
989819032 5:45772099-45772121 ACAAGGATCCCTAGGACAAAAGG + Intergenic
990166469 5:52999212-52999234 ACAATGATAAATAGGACAGAAGG - Intronic
991563675 5:67982473-67982495 ACAATGAACACTTGGACACAGGG + Intergenic
992210898 5:74478542-74478564 AGAATGATCAAAAGAACACATGG + Intergenic
994015717 5:94962697-94962719 ACAATGAACTTTGGGACTCAGGG + Intronic
995735245 5:115293952-115293974 ACAATGATCAAGAGAACAGATGG + Intronic
997712636 5:136018664-136018686 TCATTGCTCTCTAGGACACAAGG - Intergenic
998159456 5:139805158-139805180 AGCATGCTCTATAAGACACAGGG - Intronic
1003376513 6:5583110-5583132 AGAATTATGTATTGGACACAGGG - Intronic
1004484977 6:16057865-16057887 ACAAAGATGGATAAGACACAGGG - Intergenic
1008698409 6:54068922-54068944 ACAATGAATTAGAGCACACATGG - Intronic
1011063896 6:83302792-83302814 ACAATGGTGTAAAGGATACACGG + Intronic
1013573105 6:111449764-111449786 ACAATGATATCCAGAACACAAGG + Intronic
1014287297 6:119514765-119514787 GCAATGCTCTATAAGACACAGGG + Intergenic
1019829899 7:3317445-3317467 AGAATCATCTAAAGGAAACAGGG - Intronic
1028504479 7:91556245-91556267 ACAATGTTCTACAGAACACCAGG + Intergenic
1030354223 7:108525463-108525485 ACAATGATAGAAATGACACAGGG + Intronic
1030417335 7:109262204-109262226 ACAATTAACTATTGGACACTAGG - Intergenic
1032513442 7:132490147-132490169 ACAATGCTCTAAAAGACACAGGG - Intronic
1037113812 8:15199473-15199495 ACAATGATTTTGAGAACACATGG - Intronic
1041962122 8:63630357-63630379 ACAATGAACTTAAAGACACAGGG + Intergenic
1046497647 8:115035873-115035895 TCAATTATATATAAGACACATGG - Intergenic
1050681928 9:8121456-8121478 CCACTGATCTATAGAACACTAGG - Intergenic
1051475406 9:17502202-17502224 ACAGTCATCTCTAGGGCACACGG - Intronic
1052146446 9:25055944-25055966 ACAATGCTCTACAGGACAAAGGG - Intergenic
1052503140 9:29318094-29318116 ATAAGGATCTGTAAGACACAAGG + Intergenic
1052661382 9:31436800-31436822 CCAATGATCAAAAGTACACATGG + Intergenic
1056554612 9:87678130-87678152 ACCATGATCTGTAGAACACGAGG - Intronic
1056965002 9:91158164-91158186 ACAATTTTCTACAGGACACTTGG + Intergenic
1057425375 9:94944996-94945018 ACAATCATCTGGAGGAGACATGG + Intronic
1059523206 9:114963257-114963279 ACAATGATTTTTAGGGAACAAGG - Intergenic
1185793914 X:2948799-2948821 ACAATGTTTTAATGGACACAAGG + Intronic
1187375853 X:18753891-18753913 ACATTGTTCTCAAGGACACATGG - Intronic
1188399032 X:29721439-29721461 ACAATGATTTAAAGGAAAGAGGG - Intronic
1189602608 X:42643232-42643254 ACAAAGAACTAAAGGAAACAAGG + Intergenic
1195732000 X:107977733-107977755 ACATTGATCTATAAGGCAAAGGG - Intergenic
1196696201 X:118614949-118614971 AAAATGAGCTATTGAACACATGG - Intronic
1200375889 X:155779829-155779851 ACAATGATCTATAGGACACAGGG - Exonic
1202242215 Y:22782706-22782728 ACAAAGATCAAGTGGACACAGGG + Intergenic
1202395199 Y:24416450-24416472 ACAAAGATCAAGTGGACACAGGG + Intergenic
1202475586 Y:25253642-25253664 ACAAAGATCAAGTGGACACAGGG - Intergenic