ID: 1200377571

View in Genome Browser
Species Human (GRCh38)
Location X:155799898-155799920
Sequence ATGATTCTTACTTGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200377568_1200377571 7 Left 1200377568 X:155799868-155799890 CCATTCAAACAACACTTAAGAAG No data
Right 1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG No data
1200377566_1200377571 27 Left 1200377566 X:155799848-155799870 CCTCATTAAGTAATGGGCTCCCA No data
Right 1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG No data
1200377567_1200377571 8 Left 1200377567 X:155799867-155799889 CCCATTCAAACAACACTTAAGAA No data
Right 1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200377571 Original CRISPR ATGATTCTTACTTGGGATGC TGG Intergenic
No off target data available for this crispr