ID: 1200381617

View in Genome Browser
Species Human (GRCh38)
Location X:155843122-155843144
Sequence GGATCTACCATTCTGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5725
Summary {0: 12, 1: 230, 2: 1764, 3: 2103, 4: 1616}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200381617_1200381619 3 Left 1200381617 X:155843122-155843144 CCAGATCTCAGAATGGTAGATCC 0: 12
1: 230
2: 1764
3: 2103
4: 1616
Right 1200381619 X:155843148-155843170 GACAGCTTGCACCGTGCACCTGG 0: 73
1: 530
2: 1123
3: 1518
4: 1399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200381617 Original CRISPR GGATCTACCATTCTGAGATC TGG (reversed) Intergenic
Too many off-targets to display for this crispr