ID: 1200384123

View in Genome Browser
Species Human (GRCh38)
Location X:155872134-155872156
Sequence GTCATTAAGCCCAAAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200384122_1200384123 1 Left 1200384122 X:155872110-155872132 CCTTGGTAGTCATGTAATTCTAG No data
Right 1200384123 X:155872134-155872156 GTCATTAAGCCCAAAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200384123 Original CRISPR GTCATTAAGCCCAAAATTAC AGG Intergenic
No off target data available for this crispr