ID: 1200388808

View in Genome Browser
Species Human (GRCh38)
Location X:155921329-155921351
Sequence GATCTGGGTGGTGGTTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200388808_1200388814 9 Left 1200388808 X:155921329-155921351 CCCATGTAACCACCACCCAGATC No data
Right 1200388814 X:155921361-155921383 AACATTACCAACACCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200388808 Original CRISPR GATCTGGGTGGTGGTTACAT GGG (reversed) Intronic