ID: 1200394075

View in Genome Browser
Species Human (GRCh38)
Location X:155972905-155972927
Sequence AAGGGCCTGTTAAACTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 2, 1: 8, 2: 7, 3: 48, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200394075_1200394082 18 Left 1200394075 X:155972905-155972927 CCCCTAGAGTTTAACAGGCCCTT 0: 2
1: 8
2: 7
3: 48
4: 121
Right 1200394082 X:155972946-155972968 ATGCACTTGAAGGATTAGAAAGG No data
1200394075_1200394080 8 Left 1200394075 X:155972905-155972927 CCCCTAGAGTTTAACAGGCCCTT 0: 2
1: 8
2: 7
3: 48
4: 121
Right 1200394080 X:155972936-155972958 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200394075 Original CRISPR AAGGGCCTGTTAAACTCTAG GGG (reversed) Intergenic
904218814 1:28947448-28947470 AACGGCCTTTTAATCTCTTGAGG + Intronic
909804304 1:79855984-79856006 AAAGACCTGTCAAAATCTAGAGG + Intergenic
910037502 1:82805472-82805494 AAGGGCTCGTAAAAATCTAGAGG + Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
913142968 1:115960089-115960111 AAGGCCCTGTTCAGCTCAAGTGG + Intergenic
917485419 1:175450781-175450803 AAGGGCCCATAAAAATCTAGGGG + Intronic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
924429220 1:243982653-243982675 GAGGGTCTGTTCAACTGTAGAGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067021215 10:42799992-42800014 GAGGGCCTGGGAAACTCCAGAGG - Intronic
1071276395 10:84059529-84059551 AATGGCCTGTTATACTCTCATGG - Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1082682217 11:56188852-56188874 AAGGGCATGTCAAATTCTAGTGG - Intergenic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086017703 11:82187042-82187064 CAGGGCCTGTCAAACTGGAGAGG - Intergenic
1089402724 11:118173705-118173727 ATGGGCCTGTTTCCCTCTAGAGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1096541826 12:52312319-52312341 AAGGGAGTGTTAAACCCCAGAGG + Intergenic
1096788588 12:54031648-54031670 AAGGGCCCGGAAAACTCTGGCGG - Intronic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1100233398 12:92633038-92633060 CAGGACCTGTTAAGATCTAGAGG + Intergenic
1100339899 12:93668888-93668910 AAGTGCCTATTGAACTCCAGTGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1105103416 13:16492516-16492538 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105108198 13:16570300-16570322 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105134199 13:16995122-16995144 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105141249 13:17110922-17110944 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105157756 13:17379590-17379612 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105159832 13:17413695-17413717 AAGGGAATGTTCAACTCTATGGG - Intergenic
1107178938 13:37433777-37433799 AAGGGCCTGATCAACTTTTGGGG + Intergenic
1107302470 13:38980063-38980085 AAGGGCTTGATGAACTCCAGAGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1111653326 13:91121337-91121359 GAGTGCCTGTTAAAGTCCAGAGG + Intergenic
1113027985 13:105962141-105962163 AGGGGCCTGTGCAACTCTTGGGG + Intergenic
1114661942 14:24352279-24352301 AAGGACCTGTTAAACACCACAGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1131242821 15:90762389-90762411 AAGGGCTAGTTTAAGTCTAGAGG + Intronic
1133799779 16:9075717-9075739 AAGGTCCTGGTATACTGTAGGGG + Intergenic
1134205039 16:12230536-12230558 AAGGGCCTGTTCAACATTAGGGG + Intronic
1135924490 16:26680662-26680684 CAGGGCCTGATAAACTCTTCTGG + Intergenic
1137564607 16:49525205-49525227 AAGGGCCTGTTAATCCCTCAGGG + Intronic
1138454968 16:57115908-57115930 AAGGGCCTGTGCATCTCCAGCGG - Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1147666515 17:42152262-42152284 AGAGGGCTGTTAAACTGTAGAGG - Intronic
1153439439 18:5100578-5100600 CAGGGCCTGTTGATCTCTAAGGG + Intergenic
1155628087 18:27859791-27859813 AAGGGGCTATTATTCTCTAGTGG + Intergenic
1156065858 18:33141684-33141706 TAGGGCATGTTAGACTCTATGGG + Intronic
1156933819 18:42678584-42678606 AAGGGCCTATTAAACTACAAAGG + Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1168021660 19:53613237-53613259 AAGCGCCTGTCAAACTCTTGTGG + Intergenic
1168506276 19:56937786-56937808 TGAGGCCTGTTAATCTCTAGGGG + Intergenic
925722455 2:6842357-6842379 AAGGGACTGTTATCCTCTAAAGG - Intronic
929455479 2:42061869-42061891 AATTGCCTCTTAAGCTCTAGAGG + Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933591992 2:84243355-84243377 ATGTGCATATTAAACTCTAGAGG - Intergenic
935730947 2:106064887-106064909 ACTGGCCTGTTCAACTGTAGAGG - Intronic
935899001 2:107770539-107770561 AAGGGTTTGTTAAACTCAAAAGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942903177 2:181147280-181147302 AAGAAGCTGTTAAACTCTATTGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947981547 2:234414542-234414564 AAAGGCCTCTTAAAATGTAGAGG + Intergenic
1170376583 20:15707381-15707403 AAGTGCCTGGTATACTATAGAGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1178461185 21:32803814-32803836 AAGGGCCTGTGAAAATTCAGTGG - Intronic
1183916783 22:41127219-41127241 AAGGACATGGTAAACTCCAGCGG - Intronic
1184786446 22:46674224-46674246 GAGGGCCTGTTAAACTAAACCGG + Intronic
1203330676 22_KI270738v1_random:82251-82273 AAAGGAATGTTCAACTCTAGGGG + Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949357264 3:3194662-3194684 AAGCATCTGTTAAACGCTAGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
953183074 3:40614643-40614665 AAGGGACTCTGAAACTCCAGAGG - Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957034809 3:75283917-75283939 CAGGGCCTCTTAAACTTTAATGG - Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960294328 3:115924880-115924902 CAGGGCCTGTCAAAGTGTAGGGG - Intronic
961078684 3:124005504-124005526 CAGGGCCTTTTAAACTTTAATGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961304786 3:125950937-125950959 CAGGGCCTCTTAAACTTTAATGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
964767542 3:160193307-160193329 ATGGGCATGTTTAACTTTAGTGG + Intergenic
966759823 3:183407973-183407995 AAGGGCCTGTGAAACCCTGAGGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
972077472 4:35105252-35105274 AAAGCCCTGTTAAATTCTGGGGG + Intergenic
974103239 4:57440307-57440329 AAGGGCCTGTTCAAATCTATTGG - Intergenic
977258347 4:94765518-94765540 AAGTGCCTCTTAATTTCTAGAGG - Intronic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
984295881 4:177854010-177854032 AAGAGGCTGTTAAATTCCAGAGG - Intronic
988960171 5:36362976-36362998 AGAGGCCAGTTAAACTATAGTGG - Intergenic
989460118 5:41687679-41687701 AAGCCCCTGTGACACTCTAGAGG - Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
1001961673 5:175883594-175883616 AGGGGCCTGTGGAACCCTAGAGG - Exonic
1004234105 6:13858930-13858952 AAGTGCCTGTTAAGCGATAGGGG + Intergenic
1005321934 6:24664013-24664035 AAGGGACTGGCAAACTTTAGGGG + Intronic
1010840998 6:80649072-80649094 AAGGGCCTGAGAAACTCCTGAGG + Intergenic
1011935933 6:92777331-92777353 AAGTGCCTTTTAACCACTAGAGG - Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1016786762 6:148019315-148019337 CAGGGCCTGTTGACCACTAGAGG + Intergenic
1017582967 6:155887341-155887363 AAGGGCCTTTTAGACTGAAGTGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1023166359 7:37347383-37347405 AAGGGACTGTTGACCTCTAGAGG - Intronic
1025713958 7:63937207-63937229 AAGGGCATGTTATACTCTGTTGG + Intergenic
1027446262 7:78276837-78276859 ATGTGCCTGGTAAATTCTAGTGG + Intronic
1027567391 7:79813634-79813656 AAGGGCTTTTTAAACTATAAGGG - Intergenic
1028046232 7:86122938-86122960 ACTGGCCTGTTAAACTCTATGGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038613596 8:29073833-29073855 AATGGGCTGTTAATCTCAAGAGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041030934 8:53734581-53734603 AAAGGCTTGTTAAACTCCAGAGG + Intronic
1042092663 8:65175904-65175926 AAGGGACTTTTAAACTCTCAAGG - Intergenic
1042706691 8:71670767-71670789 AAGGACTTCTTAAACTCTAAAGG - Intergenic
1042743073 8:72073469-72073491 AAGGGTTTTTTAACCTCTAGAGG - Intronic
1042758811 8:72249288-72249310 AAGGGTTTTTTGAACTCTAGAGG - Intergenic
1043843518 8:85137283-85137305 AAAGGCCTCTTAAACACTTGTGG - Intronic
1048182951 8:132213231-132213253 AAGGGACAGTTAAGCTCTGGTGG - Intronic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1052553960 9:29988682-29988704 CAGGGCCTCTTAAAGTCTACAGG - Intergenic
1052810701 9:33056534-33056556 GAGGGTCTGTTATACTCTAAAGG - Intronic
1056057839 9:82846595-82846617 AAGTGCCCATTAAACTGTAGTGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1189947828 X:46197472-46197494 AATGGCCAGATAAACACTAGGGG + Intergenic
1190425839 X:50333937-50333959 AAGGGTCTGCTAAACTCTGGGGG - Intronic
1190898245 X:54641853-54641875 AAGTGCCTGTTAAAATCCTGGGG + Intergenic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1196549848 X:117010812-117010834 AAGGGCCTATAAGACTCTATAGG - Intergenic
1199970428 X:152856118-152856140 AAGGGCATGTTAAACGCAATGGG - Intronic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200912156 Y:8540210-8540232 AAGCACCAGTTAAACTCTGGAGG + Intergenic
1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201270353 Y:12248009-12248031 AAAGCCCTGTTAAATTCTGGAGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1201680512 Y:16640056-16640078 AAAGCCCTGTTAAATTCTGGAGG - Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic