ID: 1200394417

View in Genome Browser
Species Human (GRCh38)
Location X:155975097-155975119
Sequence CTGGCTGAAGGGCTACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200394417_1200394422 9 Left 1200394417 X:155975097-155975119 CCATCCAGTAGCCCTTCAGCCAG No data
Right 1200394422 X:155975129-155975151 AGCTCCCTCATCTTTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200394417 Original CRISPR CTGGCTGAAGGGCTACTGGA TGG (reversed) Intergenic
No off target data available for this crispr