ID: 1200397326

View in Genome Browser
Species Human (GRCh38)
Location X:155998941-155998963
Sequence CTGGGAGTCTGGAGGTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 526}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200397326_1200397337 17 Left 1200397326 X:155998941-155998963 CCGTCTCACCTCCAGACTCCCAG 0: 1
1: 0
2: 4
3: 57
4: 526
Right 1200397337 X:155998981-155999003 CTCACTCCAGCCCTGGCCCATGG 0: 1
1: 1
2: 4
3: 73
4: 584
1200397326_1200397335 10 Left 1200397326 X:155998941-155998963 CCGTCTCACCTCCAGACTCCCAG 0: 1
1: 0
2: 4
3: 57
4: 526
Right 1200397335 X:155998974-155998996 CAATATCCTCACTCCAGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200397326 Original CRISPR CTGGGAGTCTGGAGGTGAGA CGG (reversed) Intronic
900090665 1:919039-919061 CTAGGAGTCTGGCTGTGAGCAGG + Intergenic
900733121 1:4276030-4276052 CGGCGTATCTGGAGGTGAGAAGG + Intergenic
901229335 1:7633278-7633300 CTGGGAGTCTGGAACTGGGGAGG + Intronic
901842809 1:11964533-11964555 CCTGGAGTCTGGGTGTGAGAAGG - Intronic
902231104 1:15028199-15028221 TGGGGACTCTGGAGGTGGGAGGG - Intronic
902648416 1:17820164-17820186 CTGGCAGCCAGGTGGTGAGAGGG - Intronic
902858178 1:19224570-19224592 CTGGTAGCATGGAGGTGGGAAGG - Intronic
903561346 1:24230370-24230392 CTGCCAGTCAGGAGGTGGGAAGG + Intergenic
903795714 1:25927556-25927578 CTGGGAGTCAGGGGGTCAGGGGG + Intergenic
904009509 1:27381856-27381878 ATGGGAGTCAGGGGGTGGGAAGG - Intronic
904024256 1:27492190-27492212 CTAGGAGTCAGGACGTGAAAAGG + Intergenic
904208288 1:28869187-28869209 CTGGGAGCCGGGAGGAGTGACGG + Intergenic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904334876 1:29790297-29790319 GTGGGAGTCTGGGTTTGAGAGGG - Intergenic
904621347 1:31777196-31777218 ATGGCAGGCTGGAGGTGGGATGG - Intergenic
904698849 1:32346336-32346358 GTGGGAGTGGGGAGGTGGGAGGG + Intergenic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905261960 1:36725971-36725993 ATAGGAGGCTGGAGGTGAGTAGG + Intergenic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905689843 1:39934933-39934955 GTGGGAGACTGGAGTGGAGATGG + Intergenic
905866887 1:41381569-41381591 GTGGGAGTCGGGGGGTGAGGAGG - Intronic
906090498 1:43175468-43175490 CTGGAAGGATGGAGTTGAGATGG - Intronic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906568878 1:46819601-46819623 CTGGGAGGCTGGATGGGAGGGGG + Intergenic
906666919 1:47628473-47628495 CTGGGAGTATCAAGGTGAGAGGG - Intergenic
906789623 1:48647249-48647271 TTGGGAGTGTGGAGGTGGGGTGG - Intronic
908581831 1:65525264-65525286 CTGGAAGTCTGGGGGTGGGAGGG + Intronic
909674456 1:78223719-78223741 CTGAGAATTTGAAGGTGAGATGG + Intergenic
911326352 1:96473860-96473882 ATGGGAGTCAGGAGGTGTGTGGG - Intergenic
911467082 1:98268888-98268910 CTTCGAGTTTGGAGGAGAGATGG - Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
913243705 1:116852743-116852765 CTGGGAGTATGGAAGTGAGATGG + Intergenic
913701196 1:121376082-121376104 ATTGCAGTCTGTAGGTGAGAGGG - Intronic
914041753 1:144056549-144056571 ATTGGAGTCTGTAGGTGAGAGGG - Intergenic
914136338 1:144903937-144903959 ATTGGAGTCTGTAGGTGAGAGGG + Intronic
915129443 1:153686737-153686759 GTGGGAGCCTGCAGGTGAGGGGG + Exonic
915282385 1:154831335-154831357 CAGGGAGGATGGAGGTGGGATGG + Intronic
915512700 1:156395099-156395121 CTGGGGGACGGCAGGTGAGAAGG + Intergenic
916179408 1:162070510-162070532 GGGGGAGTCTGCAGGTGGGAAGG - Intronic
916218282 1:162417609-162417631 CAGGCAGTCTGGTGGTGATATGG - Intergenic
916459965 1:165013481-165013503 CTGAGAATCTGGAGTTGGGATGG + Intergenic
917720197 1:177779792-177779814 ATGGGTGTCCGGGGGTGAGAGGG - Intergenic
917741414 1:177964941-177964963 ATGGGCTTCTGGAGGTGAGATGG + Intronic
918244446 1:182646605-182646627 GTGGGAGGCTGGGGGTGAGGAGG - Intronic
918316671 1:183328268-183328290 CAAGGCTTCTGGAGGTGAGAGGG - Intronic
918391146 1:184064096-184064118 CTAACAGTCTGGAGCTGAGATGG + Intronic
919362334 1:196610727-196610749 CTGGGATGCTGGAGGTTAGAGGG + Intergenic
919587487 1:199456864-199456886 CTGGGAGTAAGGAGGAGAGCAGG + Intergenic
919758039 1:201078140-201078162 CTGGGAGTCAGGAGAAGGGAAGG - Intronic
919966385 1:202530749-202530771 CTGGGAGTAGGGAGAAGAGATGG - Intronic
920069424 1:203291582-203291604 CTGGGAGTTTTGAGCTGAGCTGG - Intergenic
920488621 1:206394804-206394826 ATTGGAGTCTGTAGGTGAGAGGG - Intronic
920666255 1:207964678-207964700 GATGGAGTCTGGAGCTGAGAGGG - Intergenic
921841152 1:219830021-219830043 CTGGGAGAATGGAGGCGGGAAGG - Intronic
921938296 1:220814840-220814862 CTGGGAGGCTGTGGGTGAGGAGG - Exonic
922472020 1:225882577-225882599 CTTGGAGCCTGGACGTGAGCTGG - Intergenic
922775661 1:228213262-228213284 CTGGGAGGCTGGAAAGGAGAGGG - Intronic
923765561 1:236889778-236889800 CTGGGACTGTGGATGTGATATGG + Intronic
923856032 1:237846652-237846674 CTGGGAGTCTGGGGATGCCAAGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924558458 1:245137498-245137520 CTGGAAGGCTAGAGGTGCGAAGG + Intergenic
924954562 1:248914233-248914255 TTGAGAGTCTGGGGGTGAGCTGG + Intronic
1062893728 10:1086965-1086987 CTGGCAGCGTGGAGGTGTGAGGG - Intronic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1063589850 10:7385417-7385439 CCGGGAATGTGGAGGGGAGAAGG + Intronic
1063672755 10:8112542-8112564 ATGGGATTCTGGAGGTAAAATGG - Intergenic
1064271470 10:13870078-13870100 CTGGGAATCTGGATCAGAGAGGG + Intronic
1064673630 10:17740201-17740223 CTGGGAGTCTGGAAGTTTGGTGG + Intergenic
1066242208 10:33549222-33549244 CGGGATGTCTGGAGGTCAGATGG + Intergenic
1066391597 10:34981235-34981257 GTGGGATTCTGGAGTAGAGATGG + Intergenic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1069212469 10:65779283-65779305 GAGGGAGGCTGGAGGTGGGATGG + Intergenic
1069593555 10:69656343-69656365 CCTGGAGTGTGGAGGTGGGAAGG + Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069911297 10:71761456-71761478 CAGGGAGTGTGTGGGTGAGATGG - Intronic
1070516643 10:77214255-77214277 ATGGGAGGTTGGAGGAGAGAAGG - Intronic
1071429341 10:85594198-85594220 CTGAAAGTCAGGAGCTGAGAGGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1073338767 10:102729597-102729619 CTGGGTGTCTGGATGTGTGGCGG + Intronic
1073423170 10:103440560-103440582 CCGGGAGTCTGGGAGTGAGCAGG + Exonic
1073453098 10:103621091-103621113 CAGGGAGGCTGGATGTGACAGGG + Intronic
1074522008 10:114234485-114234507 CTGGGAATTTGGAGAGGAGATGG + Intergenic
1074615770 10:115066605-115066627 CTGGGAATCAGTAGGTCAGAAGG - Intergenic
1074665184 10:115714378-115714400 CTGGGAGTCAATTGGTGAGATGG - Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075165438 10:120063901-120063923 CTGAGAAGCTGGAGGTGAGTTGG + Intergenic
1076009087 10:126972565-126972587 ATGGGAGGTTGGGGGTGAGAGGG + Intronic
1076067527 10:127460615-127460637 TTGGCAGCCTGGAGGTGAAATGG + Intergenic
1076108988 10:127846650-127846672 CTGGGAGAAGGGAGGTGGGATGG - Intergenic
1076300612 10:129423177-129423199 ATGGGAGTCTGGAGCTGCCATGG + Intergenic
1076920994 10:133454594-133454616 AGGAGAGGCTGGAGGTGAGAGGG + Intergenic
1077660012 11:4059395-4059417 CTGTGAGTCTTGTGTTGAGAAGG + Exonic
1077793786 11:5469457-5469479 CTGGGTGAATTGAGGTGAGATGG + Intronic
1078537046 11:12183579-12183601 TAGGGACTGTGGAGGTGAGAGGG + Intronic
1078670796 11:13363476-13363498 CTGGGACCCTGGAAGTGATAAGG - Intronic
1079031717 11:16991138-16991160 CTGGGAGTCTCGGGGGCAGAGGG - Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1080319362 11:30988542-30988564 CTGGGAGGCTGGAGAAGAGTGGG - Intronic
1081744870 11:45465811-45465833 CTGAGAGTCTGGTGGTAAGTTGG - Intergenic
1083572474 11:63768137-63768159 CTGGGAGTCTGAAAGAGAAAGGG + Intronic
1083574167 11:63777400-63777422 CTGTGAGTCTGGAGGTGCTGGGG - Intergenic
1083637585 11:64128819-64128841 CTGGGGATCTGGAGGTGTGGAGG - Intronic
1083998855 11:66285164-66285186 CTGCGAGTCTTGGGGAGAGAAGG - Intronic
1084161287 11:67351819-67351841 CTGGGAGCCTGCTGGTTAGATGG + Exonic
1084270975 11:68029004-68029026 GTGGGACTTGGGAGGTGAGAAGG - Exonic
1084504896 11:69559375-69559397 CTTGGAATCTGCAGCTGAGATGG + Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085051283 11:73381523-73381545 GGGGGAGTCTGGAGAGGAGAGGG + Intronic
1085278362 11:75314269-75314291 CTGGGAGGCTGGAGTCAAGAGGG + Intronic
1085530112 11:77187517-77187539 GTGGGTGACTGGAGGTGAGCTGG - Intronic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1089565084 11:119366885-119366907 CTGGGATTTAGGAGGTTAGAGGG + Intronic
1089597447 11:119589864-119589886 ATGGGAGTCTGCAGGAGGGAAGG + Intergenic
1089655859 11:119946499-119946521 CTGGTACTCAGCAGGTGAGAAGG - Intergenic
1090252475 11:125261551-125261573 CTGGGAGTGTGGTGGTGGGGAGG - Intronic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1090758999 11:129819340-129819362 CGAGAAGTCTGGAGGTGAGAAGG + Intronic
1091277209 11:134360598-134360620 GTGGGTGCCTGGAGGTGGGAGGG - Intronic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091842486 12:3630916-3630938 CTCGGAGGATGGAGGTGAGCTGG + Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092236894 12:6816041-6816063 CTGGAAAGCTGGAGGTGGGAAGG - Exonic
1092387212 12:8044957-8044979 CGGTGAGTCTGGAGTTGGGATGG + Exonic
1093382150 12:18506237-18506259 CCTGGAGTCTGGAGATGGGATGG + Intronic
1094382552 12:29858727-29858749 CTGCAAGCCTGGAAGTGAGAGGG - Intergenic
1094502162 12:31031364-31031386 CTGGGAATGTGATGGTGAGAGGG + Intergenic
1095256359 12:40041270-40041292 CTGGGAGTTTGGGGGTGAAGTGG - Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096112473 12:49037760-49037782 CTGGGGGTCAGCAGGTGAGCTGG + Exonic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096563282 12:52452110-52452132 GTGAGAGGCTGGAGGCGAGAGGG + Exonic
1096567452 12:52493220-52493242 GTGAGAGGCTGGAGGAGAGAGGG + Exonic
1097050707 12:56221582-56221604 CGAGGAGTCGGGAGGTGAGAAGG - Intronic
1097190807 12:57218517-57218539 CTGGGAGAGTGGAGATGAGGTGG - Intronic
1098564890 12:71922736-71922758 GTGGGAATGTGGAGGTGGGATGG + Intronic
1098896733 12:76071274-76071296 CTGGGAGGGTGGAAGTCAGAGGG - Intronic
1099009672 12:77276899-77276921 CTAGGAATCTGGAGGAGAAAAGG + Intergenic
1099059857 12:77894093-77894115 CTGGAAGTCAGGAGGTAAGGAGG - Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100329651 12:93571558-93571580 CTGCGACCCTGGAGGTGGGAAGG - Intronic
1101575499 12:105993361-105993383 GTGGGAGTCTGGAGGTGGAGGGG + Intergenic
1102028875 12:109728648-109728670 GTGGGGCTCTGGAGGTGAGCAGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102764822 12:115423371-115423393 CTGGGAGTTTGTAGGTGGCAGGG - Intergenic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103323022 12:120102641-120102663 CTGGGAGTATGGGGGAGAGCAGG - Intronic
1104655217 12:130569344-130569366 CTGGGATTCTGTTAGTGAGATGG - Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104971504 12:132532841-132532863 CAGGGAGGCTGGAGGTGGGTGGG + Intronic
1105258268 13:18759623-18759645 CTGGCAGTAGGGTGGTGAGAGGG - Intergenic
1105263235 13:18795515-18795537 CTGGCAGTAGGGTGGTGAGAGGG - Intergenic
1105950575 13:25225924-25225946 GTTGGAGGCTGGAGGAGAGAAGG + Intergenic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1106723859 13:32464358-32464380 GTAGGACACTGGAGGTGAGAGGG + Intronic
1107629276 13:42326950-42326972 GTTGGAGGGTGGAGGTGAGAAGG + Intergenic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1113065852 13:106373950-106373972 CTGGTTGTCAGCAGGTGAGAAGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113422535 13:110181690-110181712 CTTGGCGCCTGCAGGTGAGAAGG + Intronic
1113591462 13:111504166-111504188 GTGGGAGTGTGGAGCTGAGTGGG - Intergenic
1114317683 14:21523345-21523367 CTCAGAGAGTGGAGGTGAGAAGG - Exonic
1114412095 14:22510566-22510588 CACTGAGTCTGGAGGTGAGCTGG + Intergenic
1114530661 14:23393616-23393638 CTGGGAGTCTTGAGGAGACCTGG + Intronic
1114542275 14:23469936-23469958 CTGGGTGTCTGACGGAGAGAGGG + Intronic
1115879532 14:37899537-37899559 CTGGGAGTCTGGGGCTGACATGG - Intronic
1116887582 14:50235999-50236021 CTGGGTGGCTGGAGATGAAAGGG + Intergenic
1117246349 14:53890395-53890417 CTTGGAGTTGGGAGGAGAGAGGG - Intergenic
1119829328 14:77686965-77686987 CTGGGAGTGTCAAGTTGAGAAGG - Intronic
1120044290 14:79789322-79789344 CTTGGTGCCTGGAGGTGTGACGG + Intronic
1121320791 14:92990615-92990637 CTGGGAATGTGGAACTGAGAAGG + Intronic
1121554897 14:94829109-94829131 CTGGGGGCCTGGAGCTGGGAGGG - Intergenic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1121938504 14:98044228-98044250 CTTGGATACTGGGGGTGAGATGG + Intergenic
1122972232 14:105157033-105157055 GGGGCAGTCTGGGGGTGAGAGGG - Intronic
1124239176 15:28015903-28015925 ATGGGTGTCAGGATGTGAGAGGG - Intronic
1124514897 15:30359057-30359079 CAGGGAGTCTGAAGATGTGAAGG + Intergenic
1124728025 15:32171705-32171727 CAGGGAGTCTGAAGATGTGAAGG - Intronic
1125673169 15:41487806-41487828 GTAGGAGTGGGGAGGTGAGAGGG - Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1128234585 15:66059014-66059036 CTAGGAGTCTGGGGGTGAGTAGG + Intronic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1129675797 15:77632060-77632082 CTGGGAGCCTGGAGCTGGGGAGG - Intronic
1130250076 15:82294338-82294360 CTGAGAGTCAGGAGGTTGGATGG - Intergenic
1130878458 15:88034071-88034093 CTGGGAGTCTGGTGGCCAGCTGG - Intronic
1131265387 15:90912410-90912432 CTGTCAGGCTGGAGCTGAGATGG - Intronic
1131519109 15:93099964-93099986 GGGGAAGTCTGGAGGTGACAGGG + Intergenic
1131915410 15:97259992-97260014 CTGAGAGCCTGGAGGTGGGCAGG + Intergenic
1132311593 15:100861721-100861743 CTGGGAGGCTGGAGGGGAAGTGG - Intergenic
1132777337 16:1602480-1602502 CTGGGAGACTGGAGAAGTGACGG - Exonic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133050545 16:3115106-3115128 GTGTGAGGCTGGAGCTGAGAAGG + Intronic
1134252672 16:12585506-12585528 CAGCAATTCTGGAGGTGAGAAGG - Intergenic
1135063800 16:19292301-19292323 CTGGGAGTCTGAAGGTCCCAGGG + Intronic
1135495455 16:22947926-22947948 CTTGGATTCTGGAGCTGAAAGGG - Intergenic
1136179176 16:28539138-28539160 CTGGGAGGGAGGAGGTGAGTTGG - Intronic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1136778050 16:32882045-32882067 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1136892571 16:33979469-33979491 CTGGGGGACTGGAGGTGCCAGGG + Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137797895 16:51237581-51237603 CTGGGAGGTGGGAGGTGAGTGGG - Intergenic
1137979625 16:53058581-53058603 CAGGGAGTGTGGTGGTGAAAGGG + Intronic
1138455745 16:57119681-57119703 CTGGGAGGCTGGAGCTGGCAAGG - Intronic
1138560291 16:57797318-57797340 CTGGTAGTGTGGGGGAGAGAGGG - Intronic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139955523 16:70691302-70691324 CAGGGAGACTGGAGGTCACAGGG + Intronic
1140245453 16:73244349-73244371 CTTGGAGGATGGAGGAGAGAAGG - Intergenic
1140407209 16:74718875-74718897 CTGGGAGTCTGGCTGTGGGTTGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141461028 16:84179034-84179056 CTGGGAGTGGGGAGGTGTGGTGG + Exonic
1141717012 16:85732743-85732765 CTGGGTCTCTGGAGGTGATGAGG - Intronic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142290411 16:89191640-89191662 CTGGGAGGCTGCAGGCGAGGAGG - Exonic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203080469 16_KI270728v1_random:1144154-1144176 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1142701106 17:1661503-1661525 ATGGTTGTATGGAGGTGAGAAGG - Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142794394 17:2296323-2296345 CTAGGAGTTTGAAGGTGGGAGGG - Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143049143 17:4108554-4108576 CAGGGAGTCTGAGGATGAGATGG + Intronic
1143554090 17:7650258-7650280 CTGGGAATGTGGTGTTGAGAGGG + Intronic
1143765235 17:9133397-9133419 CTGGGAGCAAGGAGGAGAGATGG - Intronic
1143830609 17:9647590-9647612 CTAGGTTTCTGCAGGTGAGAAGG - Intronic
1144533343 17:16061941-16061963 CTGGGAATGTGGTGGGGAGATGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146256457 17:31393708-31393730 ATGGGAGTATGGAGCTGGGAAGG - Intronic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1146492622 17:33293122-33293144 CTCGGAGTCTCGAGAGGAGAAGG - Intronic
1146636713 17:34511921-34511943 CTGGGAGGCGGAGGGTGAGAAGG + Intergenic
1146641404 17:34544322-34544344 ATGGGAGGGTGGAGGTCAGAGGG + Intergenic
1147186804 17:38717499-38717521 CCAGGAGGCTGGAGGAGAGAGGG - Exonic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148144713 17:45355875-45355897 CTCAGAGCCAGGAGGTGAGAGGG - Intergenic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1149639058 17:58191486-58191508 CTGGGAGTCTGGAGCAGGCACGG + Intergenic
1150512543 17:65771912-65771934 TTGGGAGTTGGGAGGTGGGAGGG + Intronic
1150628428 17:66858692-66858714 CTGGGAGACAGTTGGTGAGAAGG - Intronic
1150642310 17:66957851-66957873 CAGGGAGGCTGGAGATGAAAAGG + Intergenic
1150974547 17:70069830-70069852 CTGGAAGACAGTAGGTGAGAGGG - Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152062342 17:78087006-78087028 CCGGGAGTCTGTGGGTGCGAGGG - Exonic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152528400 17:80902719-80902741 ATGGGTGTCTGGGGGTGAGGAGG - Intronic
1153457156 18:5295028-5295050 CTGGGAGCCAGGTGGTGAAAGGG + Intronic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1154425087 18:14265868-14265890 CTGGCAGTAGGGTGGTGAGAGGG + Intergenic
1154432780 18:14321108-14321130 CTGGCAGTAGGGTGGTGAGAGGG + Intergenic
1156360702 18:36382070-36382092 CCGGGAGGTTGGAGGTGAGATGG + Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1157076725 18:44474992-44475014 CTGGGAGTCTCTAGGTAAGCAGG - Intergenic
1157173361 18:45428453-45428475 TTGGAAGTGTGGAGGAGAGAGGG + Intronic
1158010514 18:52722391-52722413 CTGGGAGTCTGAGGATGAGAAGG - Intronic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159307937 18:66669953-66669975 GTGGGAGTTTGCAGGTGAGTAGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160178815 18:76617278-76617300 ATGGGACTCTGGAAGGGAGAGGG - Intergenic
1160568865 18:79803243-79803265 CTGGGGGCCTGGAGATGAGGGGG - Intergenic
1160607022 18:80059035-80059057 CAGGGAGTCTTGAGGTGGGGTGG + Intronic
1160965548 19:1745580-1745602 CTGGGCGCCAGGAGGTGAGAGGG - Intergenic
1160983254 19:1826376-1826398 CTGGGAGTAGGGAGGAGGGAGGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162007312 19:7788773-7788795 CTGGGAGCCGCGGGGTGAGAGGG - Intergenic
1162605985 19:11708450-11708472 CTGGGAGTCTGGAGCTTGCAAGG - Intergenic
1162721174 19:12663878-12663900 AGGGGAGTTTGGTGGTGAGAGGG - Intronic
1163334553 19:16661988-16662010 CGTGGAGTCTGGAGCTGAGATGG - Intronic
1163747435 19:19056753-19056775 CTGGGAGTGAGGAGGCGAGGAGG - Intronic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164550849 19:29211397-29211419 CTTGGGACCTGGAGGTGAGAAGG - Intronic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1164699948 19:30278198-30278220 CTGGGAGGCAGAAGGCGAGAGGG + Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165205217 19:34178599-34178621 CTCAGAGTCTGGAGGTGAAGGGG - Intronic
1165225100 19:34349237-34349259 CAGGGAGACTGGAGGTGACTGGG - Intronic
1165814759 19:38634978-38635000 CTGGCTGTCTGCAGGTGACAGGG - Exonic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1166576867 19:43849684-43849706 CAGGTAGTATGGAGGTGAAATGG - Exonic
1167070960 19:47221734-47221756 CAGGGTGTCAGGAGGTGGGAGGG + Exonic
1167633334 19:50639259-50639281 CTGGGGGCCCGGAGGTGGGAGGG - Intronic
1168362974 19:55758363-55758385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168363929 19:55768363-55768385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
925654905 2:6136104-6136126 CTGGGAATATGGAGGTGTGGGGG + Intergenic
925857679 2:8146168-8146190 CTGGGAGTGTGGAGGTGAATTGG - Intergenic
926081756 2:9992812-9992834 ATGGGAAGCTGGAGGTGAGCAGG + Intronic
927232607 2:20839442-20839464 GGAAGAGTCTGGAGGTGAGAAGG + Intergenic
927501842 2:23588389-23588411 CTGGGAGGCTGAAGGTGGGTGGG - Intronic
928173113 2:29016129-29016151 CTGGAAGGCTGGAGTTGAGTGGG - Intronic
929012614 2:37460278-37460300 GTGAGAATTTGGAGGTGAGAGGG + Intergenic
929216203 2:39416170-39416192 CTGGGAGGGTGGAGTTGGGAGGG + Intronic
929268031 2:39940525-39940547 CTGGAATTCTGGGGCTGAGATGG + Intergenic
929499848 2:42481160-42481182 ATGGGAGTCTGGAGCTGGGGTGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931246673 2:60498116-60498138 CTGGGAGAATGGAGGTGTGGAGG + Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932453970 2:71834468-71834490 CTGGGAGACTGGAGGAGGGTGGG + Intergenic
932565458 2:72904277-72904299 AAGGTAGTCTGGGGGTGAGAAGG + Intergenic
934493022 2:94775056-94775078 CTGGCAGTAGGGTGGTGAGAGGG - Intergenic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
937242392 2:120470682-120470704 CAAGGAGGCTGGAGCTGAGAGGG + Intergenic
937572082 2:123376180-123376202 CTGGGAGTAGGGAGGTGTCAGGG + Intergenic
938074626 2:128325178-128325200 CTGGGAGTCGGGAAATGGGAAGG - Intergenic
938236157 2:129708712-129708734 CTGGGAGCCTGGAGGGGACCAGG + Intergenic
938558792 2:132451246-132451268 ATGGGAGAGTGGCGGTGAGAAGG - Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
940767719 2:157808029-157808051 CTTGGAGTGTGGGAGTGAGACGG - Intronic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
942043759 2:172087303-172087325 CTGGGACTTGAGAGGTGAGAGGG - Intronic
942468789 2:176238175-176238197 CTGGGAGTGGGGAAGTGAGTGGG - Intergenic
942865620 2:180670864-180670886 ATGGGACTCTGGAGCTGAGAGGG - Intergenic
943646560 2:190412704-190412726 CTGGCATTTTGGGGGTGAGAGGG + Intronic
945279911 2:208026253-208026275 CAGGGAGTTTATAGGTGAGATGG - Intergenic
945973751 2:216254617-216254639 CTTGTATTGTGGAGGTGAGAGGG - Intergenic
946116038 2:217463276-217463298 CTGGGAGGGTGGGGGTGAGGAGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946343649 2:219089929-219089951 CTGAGAGACTGGAGGTGGCATGG + Intronic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947727340 2:232408655-232408677 CTGGCAGGCTGGGGGTGGGAGGG - Intronic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
948013788 2:234671433-234671455 CAGAGAGTCTGGAGCTGAGCTGG - Intergenic
948146806 2:235714345-235714367 CTGGGAGTGTGGGGGTAGGACGG + Intronic
948814340 2:240502279-240502301 CTGGGAGCCTGGGGGTGGGGTGG - Intronic
1169649150 20:7847594-7847616 CTGGATGTCTGGGGGTGAGGAGG - Intergenic
1171145315 20:22776283-22776305 CTGGGAGTCTGGAGGCATGGTGG - Intergenic
1171884089 20:30639259-30639281 CTGGCAGTAGGGTGGTGAGAGGG - Intergenic
1172176085 20:32972706-32972728 CTGGGGGTCTGGGTGTGGGATGG + Intergenic
1173448260 20:43139316-43139338 CAGGGAGTATGGAGGAGAGCTGG - Intronic
1174287338 20:49482717-49482739 CTGGGAGCCTGGTGGAGAGGTGG - Intergenic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174515652 20:51090434-51090456 CTGGGAAACTGGATGTGGGAAGG + Intergenic
1175797265 20:61779692-61779714 TTGGGAGCATGGAGGTGAAAGGG + Intronic
1175841123 20:62028145-62028167 CTGGGATGCTGGAGGTGCTAAGG + Intronic
1176201649 20:63863524-63863546 CCAGGAGTTTGGAGGTGGGAGGG - Intergenic
1176308473 21:5136702-5136724 CTAGGAGGCTGGAGCTGTGAGGG - Intronic
1176846958 21:13884156-13884178 CTGGCAGTAGGGTGGTGAGAGGG - Intergenic
1179044572 21:37832769-37832791 CTGGGAGCCTGGAGGTCGGTGGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179415562 21:41195580-41195602 CAGGGAGAATGGAGGTGTGAGGG - Intronic
1179531004 21:42019642-42019664 CTGGCAGTCGGGAGGTGAGATGG - Intergenic
1179791792 21:43760016-43760038 CTGGGAGTCCGGAGTGGGGACGG - Exonic
1179848586 21:44125330-44125352 CTAGGAGGCTGGAGCTGTGAGGG + Intronic
1179876578 21:44271942-44271964 CAGGGAGTCTCCAGGTCAGAGGG - Intergenic
1179886659 21:44317018-44317040 CTGGGAGGCTGGTGCTGGGAGGG + Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180121555 21:45752889-45752911 TTGGGAGGCTGAAGATGAGAGGG + Intronic
1180589705 22:16926664-16926686 TTGGGAGTCCGGAAGGGAGAAGG - Intergenic
1181557219 22:23678036-23678058 TTGGGAGTCTCCAGGTGAGAGGG - Intergenic
1181697161 22:24599524-24599546 TTGGGAGTCTCCAGGTGAGAGGG + Intronic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1181923340 22:26338004-26338026 CCGGGAGTTGGGAGGTGAGGTGG - Intronic
1182542119 22:31049336-31049358 AGGGGAGTGGGGAGGTGAGATGG - Intergenic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1183407674 22:37638486-37638508 CTGGGAGTATGGAGATGTGTGGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1183925843 22:41205373-41205395 CCCGGAGTATTGAGGTGAGAAGG + Exonic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184270752 22:43381517-43381539 CTGGGAGTCAGGCTCTGAGATGG + Intergenic
1184375806 22:44111943-44111965 CTGGGAGGCTGCGGGTCAGAAGG + Intronic
1184846263 22:47089622-47089644 GTGGGAAGCTGGAGGTGACAAGG + Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1184960849 22:47927437-47927459 CTTGGAGGTTAGAGGTGAGATGG + Intergenic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
949337127 3:2987058-2987080 CTGAGATCCTGAAGGTGAGAAGG + Intronic
949994484 3:9605551-9605573 CTGTGAGGCTAGACGTGAGATGG + Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950146826 3:10656122-10656144 CTGGGAGTTTGGAGGAGGGAAGG + Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950631240 3:14283519-14283541 CTCGGAGGCTGGTGGTGGGAAGG - Intergenic
950635913 3:14314496-14314518 GTGGTTGTCTGGAGGTGAGGAGG - Intergenic
950872967 3:16245234-16245256 GTGGGAGTGAGGATGTGAGATGG - Intergenic
951810050 3:26688813-26688835 CAGGGATTATGGGGGTGAGATGG - Intronic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954892236 3:53941396-53941418 CTGGGAGGGAGGAAGTGAGATGG + Intergenic
955785878 3:62538425-62538447 CTGACAGGTTGGAGGTGAGAGGG - Intronic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957538206 3:81533204-81533226 TTAGCACTCTGGAGGTGAGAAGG + Intronic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
959269067 3:104181951-104181973 CTGGGAGTGTGGACATAAGAGGG + Intergenic
960055187 3:113272027-113272049 CTGTGAGGCTGAAGATGAGATGG - Intronic
960163028 3:114371054-114371076 TTGGCAGCCTGGATGTGAGAAGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
962268909 3:133963622-133963644 CTGGGAGTGTGTGGGTGAGTAGG + Intronic
964303848 3:155319788-155319810 CTGGGAGCCAGGAGGTGGGTGGG - Intergenic
964834303 3:160920328-160920350 CTGGGAGCCTGGGGAGGAGAAGG - Intronic
966779046 3:183567820-183567842 TTGTAATTCTGGAGGTGAGATGG - Intergenic
967096383 3:186180781-186180803 CTGGGAGTATGAATCTGAGATGG + Intronic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967895870 3:194396226-194396248 CTTGGCGTCTGGTGGAGAGAGGG - Exonic
968108347 3:196020336-196020358 CTGCCATTCTGGAGGGGAGATGG - Intergenic
968122619 3:196136328-196136350 CTGGGAGACTGGAAGGGAGCCGG - Intergenic
968333200 3:197889533-197889555 CTGGTATTCTGGAGGTGGGAAGG - Exonic
968389485 4:177590-177612 CTGAGAGTTTCTAGGTGAGAAGG - Intergenic
968477351 4:818266-818288 CTGGGTGTCAGCAGGTGAGCAGG - Intronic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968965714 4:3768158-3768180 CAGGGAGTGGGGAGGAGAGAGGG + Exonic
969459002 4:7317743-7317765 CTGGGAGCCTGGAAGTGATATGG - Intronic
969512836 4:7629470-7629492 GTGGGAGTCAGGAGGTGGGAAGG + Intronic
970510968 4:16781443-16781465 GAGGGAGTCTGGAGGACAGAAGG + Intronic
971337126 4:25733754-25733776 TTGGGAGGCCGGAGGTGGGAGGG - Intergenic
972559960 4:40218244-40218266 CTGAGAGTCTGCAGATGAGCTGG + Intronic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
973867941 4:55133046-55133068 CTGGGATTCTGCAGGTGGGGAGG - Intergenic
974890354 4:67874579-67874601 ATGGGAGTGAGGAGGTGAGAAGG + Intronic
975300741 4:72788059-72788081 CAAGGATTCTGGAGGTGGGAGGG - Intergenic
976107906 4:81639515-81639537 CTGCCAGTCTGGAGAGGAGATGG - Intronic
978782112 4:112567036-112567058 CTAGGAGTTTGGAGGTGAGGTGG - Intronic
979748108 4:124242525-124242547 ATGGGACTGTGGAAGTGAGAAGG - Intergenic
980854172 4:138419400-138419422 CCAGGAGGCTGGAGGTCAGAAGG - Intergenic
981010590 4:139921216-139921238 CTTGGAGTCTGGATGTGAGTTGG - Intronic
981042864 4:140238912-140238934 CTGGGAGTCTGCTGTTGAAAAGG + Intergenic
982019312 4:151187956-151187978 CAGGGAGTCTGGGAGGGAGAGGG - Intronic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982112887 4:152072474-152072496 TGGGGTGACTGGAGGTGAGAGGG + Intergenic
982657833 4:158171088-158171110 CTGGGACTCTGGAGGGGCCAGGG + Exonic
982774392 4:159427263-159427285 CTGGGGGTCTTCAGGTGTGATGG - Intergenic
983266483 4:165513250-165513272 CTGGGAGACTGGAGGTGAAGTGG + Intergenic
984098001 4:175455177-175455199 GTGGGAGTGAGCAGGTGAGAGGG + Intergenic
984818183 4:183857639-183857661 CCGGGATTCAGGAGGTGGGAAGG - Intronic
984853664 4:184175070-184175092 CTGGGAGCCAAGAGGAGAGACGG - Intronic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986226945 5:5824606-5824628 CAGGGAGTCCTGAGGTGACAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
990113822 5:52363993-52364015 GTGGGAGGCTGGAGGAGAGCTGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
992348509 5:75905624-75905646 CTGGGAGACTGGAAATGAGCTGG - Intergenic
993096574 5:83485768-83485790 AGGGGAATCTGGAGGTGAAAAGG - Intronic
993149996 5:84149127-84149149 CTGGGAGTCTGGAGAGTCGACGG + Intronic
995156308 5:108917779-108917801 CTGGGAGTCTGAAGATGCCAAGG + Intronic
996321467 5:122222169-122222191 CTGGGAGTGGGGAGTTGGGAAGG - Intergenic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
998003568 5:138642766-138642788 CTGTCAGTCTGCAGGTGAGTGGG - Intronic
998178083 5:139914275-139914297 GTGGGAGTATGGCGGTCAGAAGG + Intronic
998449204 5:142221188-142221210 GTGGTAGGGTGGAGGTGAGAAGG + Intergenic
999068985 5:148723056-148723078 CTGGGAGTTGGTAGTTGAGAAGG - Intergenic
999103697 5:149049891-149049913 CTGGTAGTGGGGAGGTGAGGAGG - Intronic
999149032 5:149414656-149414678 CTTGGAGCCTGGTTGTGAGATGG + Intergenic
999201280 5:149818180-149818202 TTGGGAATCTGAAGATGAGAGGG - Intronic
999743681 5:154575804-154575826 CTTGGAGTCTGGAGGTGAAAGGG - Intergenic
1000349604 5:160343001-160343023 CTGGCAGCCTGGATGTCAGAGGG + Intronic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001936303 5:175708237-175708259 CTGGGAGTCATGAGCAGAGACGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002261961 5:177999504-177999526 CTGGGAGTCCAGAGCTGTGAAGG - Intergenic
1002355620 5:178626833-178626855 CTGGGCTTCTGGAGCTGAGTTGG - Intronic
1002508783 5:179699089-179699111 CCGGGAGGCTAGAGGTGAGAGGG + Exonic
1005990660 6:30899729-30899751 CTGAGAATCTGGGGGTGAGGAGG + Intronic
1006052846 6:31356950-31356972 GTGGGAGCCTGGGGGTGAGGAGG + Exonic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1006595939 6:35192531-35192553 CTGGGAGCCTGGAGGGGTGTAGG - Intergenic
1006919063 6:37615637-37615659 ATGGGAGTCTGGAGGTTGGGTGG - Intergenic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1009242297 6:61197611-61197633 CTGGGAGTCAGGGTGTGATATGG + Intergenic
1010383607 6:75252052-75252074 GTGGAAATCAGGAGGTGAGATGG + Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014292685 6:119577158-119577180 CTTGTAGTCTGGAAGTAAGAAGG + Intergenic
1014600571 6:123406973-123406995 CTTGGAGCCTGAAGGTGGGAAGG - Intronic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016672134 6:146721492-146721514 GGGGGAGTATGGAGGTAAGAGGG + Exonic
1018444714 6:163844862-163844884 CTTGGACTTTGAAGGTGAGAAGG + Intergenic
1018565659 6:165148987-165149009 CTGGAAGGCTGGAGGTAAGTTGG - Intergenic
1018969718 6:168517878-168517900 CTGAGAGTCTGGAGCTGGGCTGG - Intronic
1019007901 6:168817962-168817984 CTGGGTTTCTGGACCTGAGATGG + Intergenic
1019017098 6:168887995-168888017 CTGGGAATCTGCTGGTGAGATGG + Intergenic
1019293600 7:262232-262254 CTGGAAGTGTGGAGAAGAGAAGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019576391 7:1739670-1739692 CTGGGATGCTGGAGTGGAGAGGG + Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021813774 7:24428151-24428173 CTGGGAGACAGAGGGTGAGAAGG + Intergenic
1023932106 7:44712364-44712386 CTGGGAGACAGTAGGTCAGAGGG + Intergenic
1025247937 7:57331606-57331628 CTTGGAGTCTGGAGTTAACATGG - Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026897791 7:74020292-74020314 CTGGGAGTCTGGAGGGCTTATGG + Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027434319 7:78148577-78148599 CTAGGAGACAGGAGGTGAGCAGG + Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029544425 7:101202747-101202769 CTGGGAGGCTTGAGGTGGGAGGG - Intergenic
1030171409 7:106606638-106606660 ATAGGAGTCTGGAGTTCAGAGGG - Intergenic
1031746062 7:125499612-125499634 GTGGGAGTTTGCAGGGGAGATGG - Intergenic
1032151500 7:129433845-129433867 CTGGGAGACTGGAGGTCTAAGGG - Intergenic
1032439286 7:131929737-131929759 GTGGGAGTGTGGAGATGGGAGGG + Intergenic
1033268792 7:139912161-139912183 CTGGGAGGCTGGGAGTGGGAGGG + Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033756844 7:144403422-144403444 CTGGGAGACTGGAGGCGGGCAGG + Intronic
1033949822 7:146771109-146771131 CAGGGAGTTTGGGGGTGAGGTGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034439035 7:151077229-151077251 CAGGAAGTCTGGAGGGGAGCAGG + Exonic
1034470134 7:151250451-151250473 CGGGGATTCTGGAGGTTAGCAGG - Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1037077488 8:14738801-14738823 CTGTGAGTCTGAAAATGAGAGGG + Intronic
1037922391 8:22816397-22816419 GTGGGAGTAGGGGGGTGAGAGGG - Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039386759 8:37143057-37143079 GTGGGAGTGTGTAGGTGAGGCGG - Intergenic
1039625976 8:39053690-39053712 GTGGGAGTTTGGGGGTAAGAAGG + Intronic
1039842481 8:41303944-41303966 CTGGGAGTGTGGAAATGGGAAGG - Intronic
1041497518 8:58503290-58503312 CTGGGAATCTGGGGCTGTGATGG - Intergenic
1041604037 8:59759367-59759389 CTTCTAGTCTGGAGGTGAGCTGG + Intergenic
1044745232 8:95364786-95364808 CTGGGAGTCTAGAGGAGATGCGG + Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1045001184 8:97879503-97879525 CTGGGAGTCTGGCTGAGAAAGGG + Intronic
1046622047 8:116538327-116538349 CTGGGATTCAGTTGGTGAGATGG + Intergenic
1048141646 8:131800882-131800904 GTGGGTGTATGGAGGTGGGACGG + Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1049696361 8:143986046-143986068 CAGAGAGCCTGCAGGTGAGAGGG - Exonic
1049777576 8:144413677-144413699 CTGGGAGTGTGGGCGTGGGAAGG + Intronic
1049789671 8:144466850-144466872 CTGGGAGTCCCGCGGTGCGAGGG + Intronic
1051372639 9:16371394-16371416 CTGGGTGACAGGAGGTGAGGAGG - Intergenic
1052090439 9:24320648-24320670 TTGGGAGTCTGGAGGAGAGTGGG + Intergenic
1052144560 9:25032392-25032414 CTTGGAGTCAGGAGTTGAAAAGG + Intergenic
1052862762 9:33447066-33447088 CTGGGAATCTGGAGGGGTGTGGG + Intronic
1053807842 9:41821592-41821614 CAGGGAGGCAGGAGGTCAGAGGG - Intergenic
1054622750 9:67365836-67365858 CAGGGAGGCAGGAGGTCAGAGGG + Intergenic
1055301461 9:74887410-74887432 CTGAGAATCCGGAGGAGAGAAGG - Intronic
1056313821 9:85369342-85369364 TTGGGAGACTGGACATGAGAGGG - Intergenic
1056526201 9:87445328-87445350 CTTGAAGACTGGAGGTGAGGAGG + Intergenic
1058071854 9:100609459-100609481 CTGGGAGTGAGGAGGTTAAAGGG + Intergenic
1058914480 9:109552414-109552436 CAGGGAATTTGGAGGTGACAGGG - Intergenic
1060004988 9:119991975-119991997 CCGGGGGTCTGGGGCTGAGAGGG + Intergenic
1060374514 9:123106454-123106476 CAGGGAGTTTGGAGCTGATAAGG + Intergenic
1060603466 9:124893906-124893928 CTGGGAGTCCTCAGGTGAGCTGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061204711 9:129156271-129156293 CTGGGTGTCTGGAGCTGGGGCGG + Intergenic
1061360609 9:130139631-130139653 CAGGGTGTCTGCAGGTGGGACGG + Exonic
1061539601 9:131270888-131270910 CTGGGAGACGGCAGGTGGGAAGG + Intronic
1061940088 9:133879135-133879157 CTGCGAGTCTGCAGCTGAGACGG - Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062508116 9:136888548-136888570 CTTGGAGTCTGCTTGTGAGAAGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186703176 X:12113361-12113383 CTTGTAGTTTGGAGGTCAGATGG + Intergenic
1186842582 X:13499149-13499171 ATGGGACTCGGGAAGTGAGAAGG - Intergenic
1186888516 X:13938355-13938377 CCGGGACGCTGGAGGTGGGAGGG - Intronic
1189271619 X:39755898-39755920 CTGGGAGGCTGGAGGTTTGCAGG + Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1192025916 X:67451260-67451282 TGGGGAGGCTGGAGGGGAGAAGG + Intergenic
1192183384 X:68930069-68930091 CTCTGAGACTGGACGTGAGAAGG - Intergenic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1192771385 X:74195547-74195569 CTTGGAGTCTGGAGATGTGGTGG + Intergenic
1193297813 X:79852943-79852965 CTGGCAGGCTGGGGGAGAGAAGG - Intergenic
1194255205 X:91626598-91626620 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1194282406 X:91969555-91969577 TTGGGAGTCTGAAGGTGGGAGGG + Intronic
1195205896 X:102599922-102599944 ATGGGAGGCGGGCGGTGAGAAGG + Exonic
1196989784 X:121315603-121315625 CTGGGAGTCTGGAGGTATATAGG + Intergenic
1198018591 X:132636005-132636027 CAGGGCGTCTGGAGCAGAGAAGG - Intronic
1198228797 X:134670329-134670351 CTAGGAGGCAGGAGGTGGGAGGG - Intronic
1198270370 X:135051393-135051415 CTGGCAGTCTGGAGGAGTGGAGG + Exonic
1198793411 X:140370415-140370437 ATGGGAGTCTGGAGGTCGCACGG + Intergenic
1200101783 X:153691995-153692017 CTGGGGGACTGGAGGTGCCAGGG + Exonic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200209012 X:154337545-154337567 CTGGGACTCTGGTGGCGTGATGG - Intergenic
1200221864 X:154394584-154394606 CTGGGACTCTGGTGGCGTGATGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200573932 Y:4865859-4865881 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1200599995 Y:5194192-5194214 TTGGGAGTCTGAAGGTGGGAGGG + Intronic
1201269835 Y:12243993-12244015 CTGGAAGTCTTGAGGTGGGAGGG - Intergenic
1201284987 Y:12371131-12371153 CAGGTGGTCTGGATGTGAGATGG + Intergenic
1201303647 Y:12532158-12532180 ATGGGAGTTTGCAGGTGAGTGGG + Intergenic
1202302006 Y:23426543-23426565 CTGGGAGTAGGGAGAAGAGATGG - Intergenic
1202568805 Y:26244055-26244077 CTGGGAGTAGGGAGAAGAGATGG + Intergenic