ID: 1200401331

View in Genome Browser
Species Human (GRCh38)
Location X:156022093-156022115
Sequence CTTGCTCTGGATCCTGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200401331_1200401337 -1 Left 1200401331 X:156022093-156022115 CCCGCCACAGGATCCAGAGCAAG No data
Right 1200401337 X:156022115-156022137 GCACCGCCCCCTGGACGAGCGGG No data
1200401331_1200401335 -10 Left 1200401331 X:156022093-156022115 CCCGCCACAGGATCCAGAGCAAG No data
Right 1200401335 X:156022106-156022128 CCAGAGCAAGCACCGCCCCCTGG No data
1200401331_1200401344 16 Left 1200401331 X:156022093-156022115 CCCGCCACAGGATCCAGAGCAAG No data
Right 1200401344 X:156022132-156022154 AGCGGGCCCTGCAGGTCTGCTGG No data
1200401331_1200401343 8 Left 1200401331 X:156022093-156022115 CCCGCCACAGGATCCAGAGCAAG No data
Right 1200401343 X:156022124-156022146 CCTGGACGAGCGGGCCCTGCAGG No data
1200401331_1200401336 -2 Left 1200401331 X:156022093-156022115 CCCGCCACAGGATCCAGAGCAAG No data
Right 1200401336 X:156022114-156022136 AGCACCGCCCCCTGGACGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200401331 Original CRISPR CTTGCTCTGGATCCTGTGGC GGG (reversed) Intergenic
No off target data available for this crispr