ID: 1200402565

View in Genome Browser
Species Human (GRCh38)
Location X:156027948-156027970
Sequence AGCCATGCCTAGAGTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200402565_1200402574 23 Left 1200402565 X:156027948-156027970 CCCATCCCACTCTAGGCATGGCT No data
Right 1200402574 X:156027994-156028016 CCAGTGCTCAGCTTGCACCCTGG No data
1200402565_1200402575 29 Left 1200402565 X:156027948-156027970 CCCATCCCACTCTAGGCATGGCT No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200402565 Original CRISPR AGCCATGCCTAGAGTGGGAT GGG (reversed) Intergenic
No off target data available for this crispr