ID: 1200402575

View in Genome Browser
Species Human (GRCh38)
Location X:156028000-156028022
Sequence CTCAGCTTGCACCCTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200402568_1200402575 23 Left 1200402568 X:156027954-156027976 CCACTCTAGGCATGGCTCCTCTC No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data
1200402565_1200402575 29 Left 1200402565 X:156027948-156027970 CCCATCCCACTCTAGGCATGGCT No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data
1200402566_1200402575 28 Left 1200402566 X:156027949-156027971 CCATCCCACTCTAGGCATGGCTC No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data
1200402571_1200402575 1 Left 1200402571 X:156027976-156027998 CCACAGGAAAACTCCACTCCAGT No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data
1200402570_1200402575 6 Left 1200402570 X:156027971-156027993 CCTCTCCACAGGAAAACTCCACT No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data
1200402567_1200402575 24 Left 1200402567 X:156027953-156027975 CCCACTCTAGGCATGGCTCCTCT No data
Right 1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200402575 Original CRISPR CTCAGCTTGCACCCTGGCAC AGG Intergenic
No off target data available for this crispr