ID: 1200407576

View in Genome Browser
Species Human (GRCh38)
Location Y:2829125-2829147
Sequence ATGCCTTTCAGGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200407573_1200407576 2 Left 1200407573 Y:2829100-2829122 CCATGGAAGAAAAACCTAACAAA No data
Right 1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200407576 Original CRISPR ATGCCTTTCAGGAAGAGTGA AGG Intergenic
No off target data available for this crispr