ID: 1200410849

View in Genome Browser
Species Human (GRCh38)
Location Y:2860004-2860026
Sequence AGCATGACTCATCATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200410845_1200410849 15 Left 1200410845 Y:2859966-2859988 CCTATCTAAGGGATCTGGAGAGT 0: 1
1: 16
2: 139
3: 200
4: 269
Right 1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG 0: 1
1: 0
2: 2
3: 13
4: 134
1200410841_1200410849 23 Left 1200410841 Y:2859958-2859980 CCCAAATCCCTATCTAAGGGATC 0: 1
1: 10
2: 133
3: 269
4: 252
Right 1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG 0: 1
1: 0
2: 2
3: 13
4: 134
1200410844_1200410849 16 Left 1200410844 Y:2859965-2859987 CCCTATCTAAGGGATCTGGAGAG 0: 1
1: 0
2: 5
3: 24
4: 119
Right 1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG 0: 1
1: 0
2: 2
3: 13
4: 134
1200410842_1200410849 22 Left 1200410842 Y:2859959-2859981 CCAAATCCCTATCTAAGGGATCT 0: 1
1: 11
2: 143
3: 246
4: 270
Right 1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG 0: 1
1: 0
2: 2
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200410849 Original CRISPR AGCATGACTCATCATCAGAT GGG Intronic
905516610 1:38566535-38566557 GGCATCAGTCGTCATCAGATGGG - Intergenic
909768247 1:79385852-79385874 AACAGGATTTATCATCAGATTGG + Intergenic
912346484 1:108967918-108967940 ACCATGACTTCTCATCAGATGGG - Intergenic
915880688 1:159667977-159667999 ACCATAAATCGTCATCAGATGGG - Intergenic
916183323 1:162106688-162106710 AGCATTTCTCATGATCAGATTGG + Intronic
918425833 1:184408846-184408868 TGCATGAGACTTCATCAGATTGG - Intronic
918566060 1:185933613-185933635 AACATGTCTCATCATCAGTGCGG + Exonic
920459517 1:206128531-206128553 AGCAAGACTCATCATTAAGTTGG + Intergenic
921905876 1:220494977-220494999 AGCAGGACACATAATCAGACAGG - Intergenic
923195457 1:231662238-231662260 AGCAAGACTCATCTTTAAATGGG - Intronic
923468745 1:234271333-234271355 AGAATGACTCATCATACTATAGG - Intronic
923976963 1:239274701-239274723 AGCATGAGCCTTGATCAGATTGG - Intergenic
923996393 1:239499875-239499897 AGCAAAACTAATCATCATATAGG + Intronic
1063133874 10:3199943-3199965 AGCATCAGTTATGATCAGATGGG - Intergenic
1066585296 10:36927138-36927160 AGCAGGACTCTTCCTCAGAAGGG + Intergenic
1066692505 10:38044509-38044531 AGAATGACTCAACAAAAGATTGG - Intronic
1068828951 10:61470945-61470967 AGCATTTCTCATCATTAGGTTGG - Intergenic
1068883467 10:62075004-62075026 AGCATCAGTCAGCATCAGATGGG + Intronic
1070991457 10:80736559-80736581 ACCATAACTTCTCATCAGATGGG + Intergenic
1071886757 10:89959973-89959995 CGAATGACTCAGCATTAGATTGG + Intergenic
1073867790 10:107825044-107825066 ACCATCAATTATCATCAGATGGG - Intergenic
1075278743 10:121120196-121120218 GGCATTTTTCATCATCAGATTGG + Intergenic
1075886172 10:125901234-125901256 AGGATGACTCATTTTCAGGTTGG - Intronic
1075893801 10:125977750-125977772 AGCATGGCTCATCACCAGACAGG - Intronic
1083796524 11:65020070-65020092 TGCATGTCTGGTCATCAGATTGG + Intronic
1084970720 11:72770618-72770640 AGGTTAACTCAGCATCAGATGGG - Intronic
1085451779 11:76638533-76638555 TGCATGTCTCATCAGCAGAGAGG - Intergenic
1089930475 11:122305403-122305425 AGCATAACTGATCAGAAGATGGG + Intergenic
1092144406 12:6204624-6204646 TCCATGTCTCATCACCAGATGGG + Intronic
1092293034 12:7175680-7175702 AGTATGAATCATTTTCAGATTGG + Intergenic
1095434497 12:42172381-42172403 AGCATGTACCATCAGCAGATGGG + Intronic
1096897123 12:54833444-54833466 AGCACTAGGCATCATCAGATGGG - Intronic
1100620926 12:96272113-96272135 AGCCTATCTCATCATCATATGGG + Intergenic
1104259285 12:127167716-127167738 GGCATGACTGAGCCTCAGATTGG + Intergenic
1104522108 12:129485564-129485586 AGCCTGCCTCATCCTCAGGTGGG - Intronic
1109259439 13:60125735-60125757 AGCATAAAACATTATCAGATAGG + Intronic
1109667375 13:65557068-65557090 ATCATCACTCATTATCAGAGAGG - Intergenic
1111023667 13:82489779-82489801 AGAATGACTTCCCATCAGATAGG - Intergenic
1116097252 14:40386610-40386632 AGCATGACTCAACATGAGCCTGG + Intergenic
1116959824 14:50957470-50957492 AGCATGAGTCATCATCCATTTGG - Intergenic
1117338349 14:54773790-54773812 ATCATGACGCATCCTCAAATGGG - Intronic
1117672297 14:58120990-58121012 ATCATGAATTTTCATCAGATGGG - Intronic
1202871907 14_GL000225v1_random:172729-172751 AGGATGACTCATTTTCAGGTTGG + Intergenic
1127076989 15:55336645-55336667 AGGTTGAATCATCATCAGTTAGG + Intronic
1128213367 15:65917368-65917390 AGCCTGTCTCCTCATCAGAATGG + Intronic
1128524674 15:68404172-68404194 TGCCTGACTCTTCAGCAGATAGG - Intronic
1129177577 15:73851259-73851281 AGAATGACTGATCACCACATAGG + Intergenic
1130071719 15:80652134-80652156 AGAATGACTTATCAGCAGATGGG - Intergenic
1134307734 16:13048273-13048295 TGCATAACTCAAAATCAGATGGG + Intronic
1137884436 16:52087435-52087457 ACCATGAATTCTCATCAGATGGG + Intergenic
1140805095 16:78525931-78525953 AGCATGATTTATCATTTGATTGG + Intronic
1141118935 16:81335768-81335790 AGAATGACTCATCATTTGAATGG - Intronic
1145405186 17:22584014-22584036 AGCATGACTAATCCTTAGACAGG + Intergenic
1149077142 17:52608841-52608863 TGCATGACTTAGCATTAGATTGG - Intergenic
1149108976 17:53003502-53003524 AACATGATTGATCATCAGAGAGG + Intergenic
1150191235 17:63241956-63241978 AGCTAGACTCATCATCAGTGTGG + Intronic
1153327131 18:3832352-3832374 AGCTTGACTCATCACCAAAAAGG - Intronic
1154017140 18:10628608-10628630 AGCATGGCCCAGCATCAGGTTGG - Intergenic
1154187719 18:12200995-12201017 AGCATGGCCCAGCATCAGGTTGG + Intergenic
1154338776 18:13486444-13486466 TGCATAAATCATCATCAGAAGGG + Intronic
1155337780 18:24783059-24783081 AGCACTGCTAATCATCAGATTGG - Intergenic
1155442926 18:25880937-25880959 AGAATGACTTATCATCAGATTGG + Intergenic
1155926702 18:31663323-31663345 AGCATGCCTCCTCATTTGATGGG - Intronic
1156029767 18:32698979-32699001 AGAATGACTAATCATCACACAGG + Intronic
1159653458 18:71004328-71004350 AGCATGGCTCCTCTTCACATGGG - Intergenic
1159948990 18:74465645-74465667 AGCATGTATCCTCTTCAGATTGG + Intergenic
1160973758 19:1782249-1782271 AAGATGCCTCTTCATCAGATGGG + Exonic
1162072713 19:8164213-8164235 ACCATAAATCCTCATCAGATGGG + Intronic
1162575085 19:11494772-11494794 AGCCTGACCCATCACCAAATGGG + Intronic
926748572 2:16180400-16180422 AGCCTGACTTATCATCAGGCAGG - Intergenic
927071826 2:19538601-19538623 AGCCTGACTCATTACGAGATAGG + Intergenic
928373472 2:30757592-30757614 AGCATGTCACATCATCAGGGTGG - Intronic
931416856 2:62089716-62089738 ACCATGAATTCTCATCAGATGGG - Intronic
935167387 2:100581284-100581306 AGCTTGAGTCATCATCAGGTGGG - Intergenic
936040715 2:109147002-109147024 AGCCTGAGACATCATCAGGTTGG - Intronic
936458334 2:112692668-112692690 AGCATGAGTCAGCATCAGCTAGG - Intergenic
938890771 2:135703033-135703055 AGAATGACTGATCTTGAGATGGG - Intronic
940046692 2:149417120-149417142 AGGATCACTCATTATCACATGGG + Intronic
944119654 2:196227406-196227428 AGCATAAATAATCTTCAGATGGG + Intronic
1170660116 20:18330247-18330269 ACCATGCCCCATCATCAGCTTGG + Intergenic
1173375685 20:42480712-42480734 TGCATGCGTCATCATCAAATTGG - Intronic
1173407506 20:42779319-42779341 AGCATGACTCATGCCCATATGGG + Intronic
1173784517 20:45783004-45783026 CTCATGACTCATCATCATCTTGG + Intronic
1175659398 20:60799040-60799062 GGCATGTCTCTTCCTCAGATAGG - Intergenic
1180286184 22:10746757-10746779 AGGATGACTCATTTTCAGGTTGG - Intergenic
1180742457 22:18063466-18063488 AGCCTGACCCATCCTCAGAGCGG - Intergenic
1184374532 22:44103349-44103371 TGCATGGCTGATCATCAGCTGGG + Intronic
1185018464 22:48359292-48359314 AGCATGAGTCACCATGAGAAGGG + Intergenic
950501826 3:13369167-13369189 AACATCACTCATCATCAGAGTGG - Intronic
951332655 3:21384995-21385017 AGCATAAATTCTCATCAGATGGG - Intergenic
954604200 3:51895873-51895895 ATCATAACTTCTCATCAGATGGG + Intronic
958706117 3:97657944-97657966 AGCCTTACACATCATTAGATAGG + Intronic
959116950 3:102189800-102189822 AGAAAGACTCATCATTAGAGTGG - Intronic
959405918 3:105961575-105961597 ACCATAAATTATCATCAGATGGG + Intergenic
959824169 3:110773460-110773482 AGCATGCCTCGTCATCACAAAGG + Intergenic
964261718 3:154846986-154847008 AGCATGACTTATAATCAAAATGG - Intergenic
967560723 3:190916166-190916188 AACATTACTAATCATCAGAGGGG - Intergenic
970650107 4:18168298-18168320 ATCATGAGTCATTTTCAGATGGG + Intergenic
974660737 4:64885260-64885282 AGCATCACTCATTATCAAAAAGG - Intergenic
975035469 4:69674683-69674705 AGGAAGAGTCATCATCAGAGTGG - Intergenic
977486340 4:97650939-97650961 AGCATAAATTCTCATCAGATGGG - Intronic
980482327 4:133402766-133402788 CTCATGACTCATCATCAGACTGG - Intergenic
982976013 4:162061755-162061777 AGCATGAATCATCTTCAGGTAGG - Intronic
983273836 4:165593669-165593691 AGCATAAATTCTCATCAGATGGG - Intergenic
984577540 4:181468468-181468490 TGCATGTATCATCCTCAGATAGG + Intergenic
985821898 5:2166234-2166256 AGCCTGGCTCCTCATCTGATGGG + Intergenic
986097036 5:4568359-4568381 ACCATCACTAATCATCAGAGAGG + Intergenic
986576849 5:9221621-9221643 ATCATGAGTCATCATTAGAAAGG + Intronic
988621905 5:32831787-32831809 ATCATTACTCATTATCAGTTTGG - Intergenic
990077425 5:51866511-51866533 AGCATGAATTATCATGAGTTGGG - Intergenic
991081657 5:62607585-62607607 AGAATAATTCATCATCATATTGG + Intronic
992127273 5:73654590-73654612 ACCATGAGTCATTAGCAGATGGG + Intronic
994269319 5:97758490-97758512 AGCACTGCTCATCCTCAGATAGG - Intergenic
996998422 5:129727331-129727353 TGCATGATTCATCTTTAGATAGG - Intronic
1000000856 5:157137316-157137338 AGCATGTATCATAATCACATAGG + Intronic
1001310941 5:170610197-170610219 AGCATGTATCATCATCACCTAGG - Intronic
1001778532 5:174347580-174347602 AGCATGACTCAGAATGAGAGGGG - Intergenic
1002764507 6:227426-227448 AGCATGAGTCCTCATCACACAGG + Intergenic
1004747887 6:18530147-18530169 AGAAAGACTCTTCATCAGATAGG - Intergenic
1010303621 6:74290059-74290081 AGCAAGACTAATCACCAGATGGG - Intergenic
1010604173 6:77867724-77867746 AGCATGACTCATAATCCTTTGGG - Intronic
1013278433 6:108609586-108609608 AGGAAGACTGAGCATCAGATAGG + Intronic
1018059201 6:160077383-160077405 AGCATCACTCATGATGAGGTGGG - Intronic
1024094703 7:45974493-45974515 AGCATCACTGACCATCAGAGAGG - Intergenic
1024982618 7:55170406-55170428 AGCATGACTCCTGAGCAGCTGGG - Intronic
1026496691 7:70909699-70909721 ATCATGAATTCTCATCAGATGGG - Intergenic
1030495067 7:110288570-110288592 ACCATAAATTATCATCAGATGGG + Intergenic
1032672275 7:134096187-134096209 AACATCACTAATCATCAGAGAGG + Intergenic
1033437062 7:141342780-141342802 AGCCTGACTCGACATGAGATAGG - Intronic
1036160024 8:6379182-6379204 AGAATGACTCTTCTTCACATGGG - Intergenic
1038681107 8:29669458-29669480 AGCATGAATCACCAACAGGTAGG - Intergenic
1041609304 8:59826078-59826100 ACCATAAATTATCATCAGATGGG + Intergenic
1042986528 8:74589946-74589968 AGCATTTCTTCTCATCAGATAGG - Intergenic
1044162490 8:88936304-88936326 AGCATGGCACATCACCAGACAGG + Intergenic
1046245544 8:111556171-111556193 AGCATGATTTATAATCATATGGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048024607 8:130574268-130574290 TTAATGACTCATGATCAGATTGG - Intergenic
1053510981 9:38687613-38687635 AGCATGACTCATCAACTAAATGG - Intergenic
1060006559 9:120005454-120005476 AGCATGACTGACCATCACAGTGG - Intergenic
1060785664 9:126450155-126450177 AGCAGGACTCATCACCTGATGGG - Intronic
1187910004 X:24103028-24103050 AGCAAGTCTGATCATCAGAAAGG - Intergenic
1188361218 X:29256475-29256497 TGCAGGACTCAACATAAGATAGG + Intronic
1188390252 X:29610953-29610975 ACCATGAATTCTCATCAGATGGG + Intronic
1189592764 X:42532650-42532672 AACATCACTAATCATCAGAGAGG - Intergenic
1197443895 X:126524862-126524884 AGCATGACTTATAATCCGTTGGG - Intergenic
1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG + Intronic
1202050254 Y:20773477-20773499 GGCATGACTTATCATCAGATGGG + Intronic
1202178326 Y:22118048-22118070 ACCATAACTCAGCTTCAGATTGG - Intergenic
1202213035 Y:22468347-22468369 ACCATAACTCAGCTTCAGATTGG + Intergenic
1202628409 Y:56883754-56883776 AGGATGACTCATTTTCAGGTTGG + Intergenic